S03036-02_E14
Seqid S03036-02_E14
Sequence >S03036-02_E14.phd
NNNNNNNNNNTTNNNNGNNNNNTNNNNNGGGCGATTGGCGGCCAAATCGGCCGAATTGGA
CACATTATAACTAATCAGTAGTATACTTTGCACTTTCGATATTCTTTTTCACTAATCTCC
TCCCCAACCCCTTATTGAAGATAAAAAGAAAGAAAGAAAGAAAGAAAAAAATCCAATTTC
ATAGTACGAAGAAGAACGAGAATAAAGATGCTATCGCTAAAAAAATCAGCGCTCTCCAAG
TTGACTTTGCTCAGGAACACAAGAACATTTACATCGTCAGCTTTGGTGCGCCAAACGCAG
GGCTCTGTAAACGGTTCCGCGTCCAGATCTGCAGACGGGAAGTACCACATAATAGATCAC
GAGTATGACTGTGTGGTAATCGGTGCCGGTGGTGCCGGCCTTAGAGCGGCCTTTGGTCTT
GCCGAGGCGGGCTACAAGACTGCTTGTATATCCAAGCTTTTCCCCACCAGATCCCACACT
GTTGCTGCTCAGGGTGGTATCAATGCCGCCCTGGGAAATATGCACAAGGATAACTGGAAA
TGGCATATGTACGATACTGTGAAGGGATCTGATTGGCTAGGTGACCAAGGACTCCATCCA
TTNNATGACCAGGGAAGCGCCCAAATCGGTCATTGAACTGGANCAATATGGTGTANCCTT
TATCAAGAANTGAAAANGGGANAATCTACCGAAGNACNNGGNGANGGTCAGAGAAGGAAA
CGGTTAAAGGTGGTTNNANGANATGAAAGGAGGGAGGTNCAAAGANNGGACAAGATTAAG
CNCTNTTTAAAACCNNTCTTATNNGGAGAGTNATTNGAAGGTTNAAATATATTNTAATTA
AAGAAGATTGGCAGAGGTAAGTNAANGTATTATGGGGAGGAGGGGGGNNTGAANATTATN
ATAAGATNAATCGGGNANATATTAANTAAAAANCGTCGN
Quality >S03036-02_E14.phd
5 5 6 5 6 6 6 6 3 6 10 12 7 5 5 6 12
5 3 6 7 5 9 7 5 5 3 7 8 21 27 9 23 29
15 36 43 20 18 41 21 16 29 12 23 28 40 43 47 25 37
44 41 34 12 25 49 50 42 20 14 28 37 31 43 42 49 46
37 40 52 40 43 43 35 31 28 37 42 49 40 40 54 49 43
43 49 50 50 50 42 42 42 49 49 46 46 42 44 43 43 44
50 54 46 60 47 47 42 34 35 38 44 40 39 60 60 50 60
49 54 60 57 60 52 52 57 60 60 60 52 57 63 60 52 60
60 57 57 57 52 52 63 60 58 60 63 63 63 63 63 63 63
63 63 63 63 63 43 63 63 63 63 63 63 63 63 63 63 63
57 52 57 52 52 58 63 63 63 63 52 63 63 58 57 60 58
60 60 52 52 63 63 54 63 58 63 60 63 58 63 52 58 63
63 63 60 52 57 63 57 52 57 57 57 57 58 52 54 60 60
60 60 60 52 52 57 52 52 58 54 52 52 52 54 57 52 52
48 47 43 23 48 52 35 48 60 57 60 57 57 57 57 52 63
63 57 59 60 63 59 58 63 58 54 60 57 63 63 63 60 63
57 63 63 63 58 63 54 60 57 58 60 63 63 63 63 63 63
54 57 58 59 60 58 63 58 63 60 54 58 60 57 57 57 63
63 58 58 63 58 54 60 63 57 63 63 58 54 58 63 58 63
52 52 58 63 63 63 58 58 60 59 57 54 54 59 63 60 58
60 60 60 52 52 52 57 60 60 60 60 60 60 58 59 57 52
54 59 54 60 58 63 58 54 54 58 57 54 60 63 58 63 63
63 58 60 60 63 54 63 60 54 60 58 54 60 54 54 60 58
59 59 52 49 49 60 47 50 47 47 49 50 58 58 47 49 60
50 50 60 54 60 54 57 54 60 54 60 60 57 47 60 54 58
47 42 46 49 49 49 49 47 49 54 60 49 49 58 47 60 63
54 60 60 63 60 50 60 54 60 58 47 47 57 50 50 54 60
60 54 60 60 49 49 54 54 50 54 54 52 47 60 60 47 42
60 44 49 54 54 47 49 49 47 50 50 44 50 42 60 44 50
51 47 60 49 42 60 47 60 50 47 49 50 39 49 47 42 47
40 44 44 44 30 42 50 52 54 44 44 44 42 42 35 30 40
42 60 44 44 47 47 50 50 60 42 30 33 35 30 32 35 60
31 36 36 47 15 10 8 60 35 54 29 44 44 42 35 32 27
35 32 13 15 27 32 18 35 39 42 41 12 15 39 44 11 9
12 10 31 19 38 38 27 35 12 14 13 13 12 11 11 31 22
9 15 9 9 16 29 19 7 7 9 11 17 11 19 34 13 13
21 18 31 52 35 42 16 21 21 35 23 15 11 12 11 12 9
8 12 32 12 19 23 32 25 11 35 20 16 9 7 9 25 10
20 35 20 20 24 29 12 11 10 6 9 12 13 14 9 10 12
20 33 32 28 37 11 6 9 13 44 28 28 11 6 10 12 8
13 7 9 13 9 13 16 11 22 16 9 41 29 11 6 9 8
6 6 10 9 6 11 11 6 26 14 9 10 10 10 10 8 10
12 15 16 16 11 10 9 11 10 9 9 24 13 9 18 28 16
26 10 10 9 6 6 10 6 9 16 7 9 9 11 11 22 16
10 11 9 11 8 9 9 13 19 10 6 8 10 11 20 11 10
7 7 14 9 11 9 10 11 10 11 10 9 18 15 19 10 6
10 11 6 9 10 11 10 20 23 10 11 9 6 6 9 10 11
10 9 14 6 6 9 11 14 9 8 10 10 7 10 12 15 6
11 17 9 11 11 11 9 7 10 22 28 11 9 9 9 11 10
6 11 11 18 12 10 10 8 13 12 11 10 16 19 17 16 18
9 15 11 11 11 11 10 10 9 9 9 13 7 10 11 6 10
9 17 14 9 23 10 9 15 11 9 19 8 9 11 18 15 10
9 19 16 6 6 9 10 14 10 6 10 10 11 14 11 6 9
11 9 13 11 9 9 6 11 11 10 11 11 14 10 6 9 6
23 10 8 8 8 10 11 6 10 11 18 10 10 9 6 9 9
11 9 8 6