S03036-01_C03
Seqid S03036-01_C03
Sequence >S03036-01_C03.phd
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCGATTGGCGGCCAAATCGGCCGAATTGG
GCCCCTCCGCAAACAATTGCAGCACCTTTGAATAATAATTCGAATACAAACATTGTCAAC
GATGATAATGCAGTAGCAGGAACCGTAAACTACGCTGGCCTTCATGACGAATTGTGAATA
ACGAAATAATATATATTAATGTTAAATATGATTACATAGCTTTGTGCACATATCTCTATG
TCATCTTTTATGCATTTATATTTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGTACCGG
CCATAAGGGCCAGCTTGAGTATTCTATAGTGTCACCTAAATAGCTTGGCGTAATCATGGT
CATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCG
GAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGT
TGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCG
GCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTG
ACTCGCTGCGCTCGGTCGTTCGGGTGCGGGGAAGCGGANTCAGCTCACTCAAAAGGCGGT
AATACGGGTATTCACAGAAATCANGGGGATAACACAGGAAAAAACATTTNAAACAAAAAG
GGCCAGAAAAAGACCNGAAACCCTAAGAGGGCGNGGTTGGCGGGGGTGTTTCATAGGGGT
CCNACCCCTGAAGAAGATACATAAAAACTCAAGCTCAAGGTGGAGGTGGNNATCTCTAGA
GAGACAAAAGATAACANAGAGNTACCACCAGAGAACACCATGGAGAGAACGCANGGGGAG
GAGCAAAGGGGGTAGAANGGANNAACAACCN
Quality >S03036-01_C03.phd
18 6 5 3 2 3 4 2 4 3 4 3 5 6 3 3 7
7 5 5 3 5 7 5 3 5 3 5 7 7 14 14 11 27
25 15 28 27 10 12 32 22 12 27 12 16 15 35 30 40 31
33 27 25 19 10 30 30 25 14 9 14 25 33 34 37 50 35
26 25 16 18 35 27 30 34 30 35 40 35 31 40 49 28 35
37 32 36 34 42 27 28 46 30 41 37 35 33 31 37 36 36
38 54 59 40 46 26 29 33 43 34 38 42 49 42 42 42 50
54 50 50 54 47 45 49 49 49 54 54 54 54 50 50 54 54
59 59 50 46 45 42 44 49 50 50 54 54 54 47 50 50 49
43 43 43 45 51 49 43 43 63 46 43 43 43 45 47 49 47
49 50 63 63 50 60 50 60 60 49 49 50 50 54 60 57 60
46 60 60 60 63 63 63 60 63 63 63 60 58 63 58 52 57
63 63 60 60 63 63 43 43 43 57 63 42 58 52 60 60 63
60 63 63 58 52 57 52 48 57 57 57 57 57 57 48 52 57
57 60 43 43 32 43 57 57 60 63 58 57 52 63 60 60 63
63 53 57 58 60 63 53 53 63 57 63 53 53 63 63 63 63
63 63 63 63 63 63 63 63 63 63 63 63 63 63 63 63 63
63 53 57 60 52 57 57 52 60 60 58 52 52 57 60 57 60
57 60 52 52 57 57 60 57 57 60 48 48 57 57 52 46 60
60 52 60 60 57 57 57 52 57 57 52 52 57 52 57 60 57
60 52 57 57 60 60 57 52 52 52 57 57 57 46 60 60 43
60 57 57 60 60 57 57 60 57 57 54 59 63 57 60 44 60
60 52 57 60 60 57 60 57 52 57 52 58 57 47 57 57 57
44 52 52 57 46 57 52 49 60 49 60 58 44 60 47 54 47
60 50 54 60 60 60 42 43 42 60 60 60 60 47 46 42 42
24 47 50 60 49 50 54 49 50 50 50 47 49 60 49 54 54
58 60 47 38 47 49 47 50 54 60 54 54 60 60 50 54 54
39 50 42 42 36 26 20 19 17 20 17 33 46 42 50 43 49
43 44 31 43 43 43 39 34 44 39 42 28 39 42 43 35 42
42 50 44 54 59 54 42 54 36 59 54 39 42 50 50 54 57
54 35 54 50 44 42 42 37 42 54 24 54 34 30 43 49 33
42 39 32 32 39 29 27 33 29 36 26 39 37 32 24 43 42
50 38 31 35 30 33 25 26 26 39 33 21 38 16 43 27 32
34 25 35 42 42 31 23 16 8 13 34 42 37 42 21 23 27
24 29 27 27 17 24 21 22 24 25 19 21 19 25 18 28 23
15 17 16 28 27 31 23 23 21 11 25 33 21 16 14 21 21
22 25 24 16 16 19 18 17 15 25 28 13 12 17 12 10 19
22 23 26 18 20 27 21 31 8 7 19 10 13 11 30 38 28
30 22 30 17 19 24 24 13 32 28 15 18 21 21 21 26 18
21 21 21 28 12 27 16 14 11 13 10 16 16 12 10 31 32
21 22 18 6 19 18 18 14 15 21 21 24 16 16 16 9 15
17 30 17 22 11 19 19 18 14 16 10 9 6 10 24 13 19
26 54 37 43 36 22 30 12 18 14 15 14 17 22 35 41 23
14 9 8 10 7 12 12 16 13 28 31 14 13 30 27 8 29
11 10 10 12 11 7 11 10 11 16 21 23 14 14 30 24 20
30 16 20 18 16 17 12 11 11 16 10 13 11 14 15 11 16
7 17 21 27 21 13 12 14 14 8 11 22 23 23 17 20 11
11 16 11 26 11 23 19 21 11 11 11 13 11 12 10 10 8
21 20 18 11 15 10 10 13 12 23 13 17 10 7 7 15 9
9 11 18 9 9 11 14 9 11 8 16 12 11 10 21 21 24
33 14 30 27 10 26 6 15 20 12 17 6 10 22 10 12 11
19 19 15 15 23 11 11 10 8 9 16 14 11 10 10 11 11
14 13 12 10 11 12 17 13 11 7 11 11 14 12 13 12 9
9 10 14 14 13 11 14 16 19 19 11 24 20 16 11 10 7
15 11 16 7 7 21 12 11 12 13 8 9 6