S03036-01_C05
Seqid S03036-01_C05
Sequence >S03036-01_C05.phd
NNNNNTTNNNNNNNNNNNATNNNNANNNGCGATTGGCGGCCAATCGGCCGAATTGGCACT
ATTCCGGCAGCTAGTTGATACTATAACATCCTACATTTTTACTTGTTTTACGTTCATTTT
TATTTGAAGTTTGTAAACTTTATCAGAAAGAAAACAAGAAGAGGAAAAAGGAAAAGAGGG
GTCAGGTTAGTATCAATAAAAAAAAAGAGAGTAAACAAAACAATACGAACTCAATTGAAG
CACTATAAGAATGGTAAAGATTGCGATAATTACTTACTCTACCTACGGGCACATAGACGT
TTTAGCCCAAGCTGTTAAGAAAGGTGTGGAGGCAGCTGGTGGTAAAGCTGATATATACAG
GGTCGAGGAAACTTTACCTGATGAAGTCCTCACCGAGATGAACGCTCCTCAGAAACCTGA
AGATATTCCTGTTGCTACTGAGAAAACGTTGCTCGAATATGACGCCTTTTTGTTCGGTGT
TCCAACTAGGTTTGGTAATTTGCCGGCTCAATGGTCCGCCTTTTGGGATAAAACCGGTGG
ATTATGGGCCAAGGGCTCTTTGAACGGNAAGCTGCGGGGATATTCATTAGTACTTCCAGT
TNAAGAGGTGNNCAAGAAAGTACCGTTTNAANNCTGTTNGTCTTATTNAGGTTATCACGG
AATTGATTTTTACNAATGGGTTATAAGAATTCACTTGCTAAGATAGCCANTAAAGAAAAC
TTAGACCCGTGCACTCCAAGGGGAGCAAANAAAAATANTNTATCNTCAAGANGAAAAAAA
TCGTTNGAGANNGAGTAACACCCGGCTGGGANNGATGTAAANGGGAAGAAAGANANNAGG
AAAAGCAAANTATCGAAAANAAGANAGNGGAGGAANGAGAAGANNAGTNAGNGCAGGGGN
NTNTNGGAGTNANNN
Quality >S03036-01_C05.phd
2 3 3 4 3 11 11 2 3 7 6 6 6 5 4 3 4
5 8 8 3 5 5 6 10 5 3 5 8 9 9 12 10 16
19 10 11 28 26 16 16 29 16 41 31 42 32 36 44 33 25
12 32 40 35 21 27 15 23 31 28 48 48 47 43 41 44 41
35 32 49 32 35 35 37 39 40 25 26 35 29 43 43 50 49
51 42 21 49 49 46 41 46 49 31 50 49 49 40 42 46 43
49 49 49 46 46 40 35 43 42 43 46 35 35 42 50 43 43
46 34 50 50 46 53 53 53 53 53 53 53 43 53 50 54 53
43 47 51 53 45 57 63 51 45 60 63 63 63 63 63 63 63
63 51 58 63 63 63 63 50 63 51 63 63 63 63 63 63 58
63 63 58 60 63 58 63 52 63 63 63 60 58 60 52 63 63
63 58 58 63 58 58 63 60 63 53 63 63 63 63 53 53 63
63 63 60 63 57 63 60 60 60 63 63 60 60 57 60 57 60
59 57 48 57 53 60 53 57 58 57 63 57 57 63 63 48 43
43 57 60 52 52 63 57 58 60 63 57 63 60 52 63 63 60
60 63 63 60 52 46 63 63 52 52 63 60 60 63 52 63 60
57 60 63 60 57 57 58 52 48 48 63 52 57 57 52 63 63
63 57 57 57 60 57 57 63 52 59 58 63 63 63 57 59 57
63 58 59 63 57 63 58 60 60 60 57 63 57 63 58 58 57
63 46 58 52 58 63 58 47 63 52 60 59 54 59 58 63 60
63 63 57 60 58 58 52 54 60 60 57 46 60 57 59 57 57
43 21 43 63 63 52 58 47 58 47 58 53 58 58 52 60 63
58 57 52 57 57 57 53 46 57 53 63 52 60 60 63 57 60
57 52 57 60 53 35 52 42 60 57 63 52 52 53 59 60 63
54 60 52 35 63 58 57 57 58 59 59 54 63 46 52 29 52
52 63 60 58 60 63 59 58 59 47 52 46 52 59 59 52 35
52 63 43 41 40 52 52 60 57 57 57 60 60 57 57 52 42
40 47 46 44 52 44 60 42 60 57 52 57 52 39 60 52 44
52 46 60 35 57 44 52 44 52 57 52 46 47 60 35 37 60
60 60 28 32 60 47 43 42 52 39 57 52 57 52 60 35 44
60 60 60 52 42 52 47 35 39 47 60 40 36 40 52 35 34
32 17 29 29 19 15 29 52 40 46 27 40 41 30 31 57 34
18 33 16 10 11 20 17 25 42 57 42 39 35 35 41 52 52
31 35 21 23 28 13 6 8 28 13 39 41 32 21 10 20 35
35 15 10 11 11 11 13 8 18 42 28 16 19 18 20 24 30
23 16 14 20 17 16 6 8 11 11 19 9 11 23 16 6 6
9 21 14 8 22 37 35 9 12 18 13 11 16 26 40 9 6
10 9 6 6 13 11 16 9 13 7 19 19 18 19 22 14 19
13 6 10 13 11 11 8 11 11 12 12 16 34 27 28 27 18
18 11 9 11 34 50 37 14 10 9 6 9 11 16 25 11 8
11 21 16 12 9 13 14 30 32 9 19 13 11 8 20 14 11
14 10 9 25 11 10 11 11 8 13 16 12 6 11 14 11 21
22 19 16 12 10 9 8 11 9 9 11 11 9 11 10 14 12
10 10 12 12 11 20 11 13 16 13 12 12 11 18 9 10 14
10 7 12 10 10 12 9 11 9 6 10 6 9 15 11 9 6
11 11 14 17 16 11 6 9 9 15 17 29 19 10 11 10 13
10 10 10 7 10 9 12 9 7 7 9 11 10 10 11 9 9
13 9 10 8 12 15 10 11 11 11 9 9 6 6 9 11 8
12 10 16 9 11 7 11 9 9 11 9 10 9 11 14 9 9
6 11 6 6 17 8 11 9 10 16 12 11 8 10 10 8 7
11 11 10 9 10 11 11 11 9 6 11 10 14 14 6 10 9
7 11 11 11 22 10 10 8 6 9 14 10 9 9 10 19 6
6 9 8 9 6 8 9 6 11 10 14 10 10 9 9 6 6
8 7 9 6 16 8 8 9 11 7 11 7 6 6