S03036-01_C06
Seqid S03036-01_C06
Sequence >S03036-01_C06.phd
NNNNNNNNNNNNNTTTNNNNNNNNANNNNNNGGGCGATTGGCGGCCAAATCGGCCGAATA
TATTTATTTTACCAGCAGGAATTCGTCTTTAATATCGTTTCGACCATCGATCATTCCTCT
GAGTATTGCAAAAACATTTTTGGAACAACCCAAACTTAAAGTTACAAAACTCAAAAAAGG
AACAAAATTAATAAAACAAAAGAATCGCTGTTAGAGGTTTATTGTTGCACTAATAGAAAA
TCATAGAACTTTAAAAATTATACTAGAAAGATGTCACAACAAGTTGGTAACAGTATCAGA
AGAAAGCTGGTAATCGTTGGTGATGGTGCCTGTGGTAAGACATGTTTATTAATCGTCTTT
TCCNNGGGCCAATTTCCAGAAGTCTACGTACCAACTGTCTTTGAAAACTATGTAGCAGAT
GTNGAAGATGATGGGCGTCGTGTANAGATAGNGCNATNAGAAANNNTGTCGCCAANGGNA
TNGGGAGAGGATGGNGGATTGANATGTCCTGGANAAAAGANACAANNAAACGAGCAAACA
AGNGCGAGGNNAGCGNCAGCAGNATTAAAAGGCATGNAGGTAGAAAAGTAACANNTAGAC
CGATGACAAANTGTNCTAATCTANNATGCANGGNNGNAGNCNNNTGNAANAATGTTAGTA
GNGCCGGGGAGCAAGTANNGAAAGNTGTNTNAGGANNAGNGACNNTCACCGNNNNAGGGC
AGGTATGTNGGTTANNAAAGTNNNANGNNANAANCGGNTTANACGAAGGGGTNAAGTAGG
CCGTAAAATTNGAGTANNTNNNTNTNAAANNNTGAANANGTACNCNGGATATAGTCNGTG
TTNNAANTGGTGGANNANNANCCATGGNNNAGNTTNAANNA
Quality >S03036-01_C06.phd
5 5 5 5 2 3 4 4 2 4 6 4 4 12 11 8 3
6 5 3 3 5 5 5 8 7 5 5 5 7 7 8 26 21
13 25 29 16 42 27 14 18 36 26 20 26 10 10 27 42 41
48 32 40 52 41 32 18 40 18 41 21 35 49 34 31 34 50
49 31 28 37 21 20 34 42 35 26 40 25 28 28 46 42 36
52 41 33 34 26 28 35 46 54 49 43 35 42 37 29 36 24
32 42 42 25 49 49 39 38 42 44 44 44 44 49 46 46 44
44 44 44 44 44 47 33 44 49 54 60 50 60 49 47 49 47
50 63 60 47 43 45 50 52 57 57 44 57 58 63 63 57 63
63 58 63 63 57 47 43 63 63 63 60 63 57 57 60 57 63
60 52 52 60 58 58 60 60 57 63 58 57 57 57 60 60 57
53 63 57 57 60 57 57 63 63 63 52 57 63 63 57 58 52
53 53 53 52 52 57 60 52 57 52 52 52 52 52 48 48 60
52 60 52 52 57 52 57 42 52 52 52 60 52 57 47 42 47
42 43 43 37 35 27 36 37 35 40 57 57 48 48 47 60 60
57 57 48 53 40 60 60 58 58 57 57 53 48 60 57 52 42
63 57 48 60 57 60 57 57 57 48 60 60 60 52 52 60 47
60 57 42 60 58 52 52 52 46 46 57 53 43 52 52 60 52
52 60 48 53 41 48 48 43 48 35 48 43 28 24 48 48 48
27 48 48 47 57 47 43 48 60 48 42 48 20 26 35 42 48
23 27 42 42 29 35 27 33 29 19 24 24 30 36 35 30 30
23 41 32 19 35 12 7 7 9 16 15 14 29 35 32 32 44
44 45 45 39 47 43 44 35 57 57 37 20 47 41 53 20 53
45 42 27 53 53 53 60 53 53 42 35 15 17 28 9 10 11
23 45 10 11 11 10 42 53 53 24 38 12 14 12 6 8 9
24 14 9 11 18 31 19 29 32 24 19 19 10 12 9 10 17
19 31 6 11 14 9 17 12 8 6 10 10 6 10 18 7 10
13 10 10 12 6 6 6 9 9 9 9 15 14 12 11 11 7
9 10 6 16 10 6 9 14 15 24 14 9 9 11 11 8 10
14 6 9 11 14 11 11 10 11 6 14 10 10 11 12 11 9
13 10 9 7 11 8 10 11 14 10 7 9 10 10 9 6 6
14 11 14 9 11 9 14 9 14 11 9 10 14 10 9 6 10
11 14 16 9 11 6 6 10 10 8 9 6 9 9 14 8 8
9 6 9 11 14 14 13 9 9 11 9 8 9 9 10 6 10
13 9 9 9 9 10 12 9 14 9 10 15 11 10 11 6 6
9 10 10 11 11 9 10 11 11 9 14 12 11 14 9 6 10
14 10 7 9 9 10 11 14 11 14 14 6 6 14 14 8 11
14 6 10 10 5 6 10 6 11 8 6 8 6 6 6 8 11
6 10 14 6 9 14 12 11 9 11 14 9 10 14 10 6 9
11 11 9 9 9 11 11 11 9 14 14 14 14 11 6 6 10
14 10 10 9 6 10 9 9 7 9 6 8 9 8 11 6 6
10 9 7 9 10 9 6 6 9 9 14 9 8 8 6 6 6
6 11 14 10 10 11 10 10 11 8 11 10 9 9 6 14 9
11 10 9 6 7 9 9 11 11 9 6 6 7 9 6 9 6
6 10 6 11 8 6 10 10 11 6 8 9 14 6 10 8 9
14 11 9 9 11 11 9 6 9 9 8 9 9 9 9 8 8
8 14 9 10 10 14 9 8 7 8 9 9 10 9 7 6 9
6 6 7 8 6 11 7 15 9 9 7 6 6 9 9 8 9
6 11 7 9 8 11 8 6 11 6 16 9 9 9 9 8 9
10 10 9 6 9 11 9 9 8 6 6 8 9 6 11 10 9
8 9 10 9 6 6 9 7 6 9 6 8 9 10 9 9 9
7 6 6 8 9 7 9 8 6 8 9 6 6 8