S03036-01_C08
Seqid S03036-01_C08
Sequence >S03036-01_C08.phd
NNTTTTNTTNNTNCGGNTCNNNNNATANNNNGGNTGGNGGGGNGGGGGGGAATTGNCCTC
CAGCATCTCATAATATGTCTTCACTGCTAAACACGACAGTAACGCTAGCCCAAATTCTGA
CTCTGAAGACGGTCACCACCACAACAATAAGAAGGAATGCGCTATCGAATATCTGAAGGC
ACGGTTAAATAGTGCATCAGCAGTCGCTTGCGGCTACCTCCAAGCTTTTGTCAGTAAGAC
GCAAGACTTTGCCAAAGTATGCTTTTTAGAACTTCAGAATCCCGTTGTCTTGGTCAACTT
GTTGCTGCATTCTTCAGTGGTATGTTATTTATGTAACGGGTNNGCGAACCACAACGCCAG
ATTCTTGAAGGGGAAACCTAACTCTACAGTCTTANCAACAACCGCCNGCGCTCTGGGTCT
TTTNNCGCTGGACCGTATAANTTCAAAAAAAAATTACTNNNTTCCCACAAGAAAGCAAAG
NGGGGGNCTTAACAGCTCTTATAATNATANTAAAAAGTTCTGTGAAAAGTTTANGAAANN
GGGGGAAAGGTCAGNANATGTGAAGAAAAAANNAAAAAAAGCCNAGCCTNNCTCCCNGTT
GNGTAGGNGGGANAANAGAANAAAAAANTTAATCAATTTTTTTACTTCAATGTTGTACCA
CTCTANGATGGAAGAAAGGAAAAAAANGNNNGACAAATATAAATACCNAACGCTAGGTCC
ACGGGNAAGGGTTTAGANGGTNNGGNNAANATATTNAANGTNNCTACTTNGAAANAATAG
NNAGNANAGNNAANAGCTGANANGACGGGACGCNAANGGGAAGTCCANTTGGNAGAAANT
NGANGCAAGGCANTANGTAGNNANGGTTAGTGGNAAAAAACANAGCCGNNTGCNNNCGCT
GGCG
Quality >S03036-01_C08.phd
7 7 16 19 23 11 5 13 12 7 5 8 5 9 15 9 5
8 9 6 7 7 7 7 8 8 11 5 7 7 7 12 11 5
16 12 15 6 14 17 11 11 6 9 9 9 26 22 9 10 18
9 17 14 10 6 9 10 19 13 12 13 14 18 12 28 25 33
19 20 28 33 34 35 23 20 35 31 19 19 19 11 9 16 42
40 28 25 26 35 31 47 19 39 13 22 41 24 28 9 11 13
15 23 16 15 19 33 23 23 26 29 19 23 39 39 45 39 44
41 52 60 45 35 28 31 29 26 30 45 45 57 57 52 42 48
48 60 52 58 52 52 35 60 52 52 57 57 60 57 57 53 60
52 48 57 52 52 52 52 52 48 52 57 60 57 47 52 57 60
60 52 57 60 60 52 57 52 52 60 46 54 57 60 57 52 52
60 60 60 57 57 60 57 57 60 57 57 57 42 60 46 46 42
47 34 52 60 52 57 60 42 47 52 52 46 52 57 52 57 42
35 32 36 47 42 41 41 28 47 31 22 22 35 31 22 21 33
48 40 40 40 47 46 52 52 42 57 63 52 52 42 32 27 42
46 46 52 46 57 57 43 53 48 48 48 48 48 57 58 48 40
48 48 48 37 52 52 60 60 60 48 53 48 48 48 48 47 60
48 48 48 43 40 52 41 43 35 34 26 43 34 43 43 37 48
48 43 25 40 48 57 42 35 32 34 32 42 48 48 43 44 32
48 32 45 53 33 57 35 47 32 29 29 18 35 20 22 20 19
11 5 7 21 20 18 19 35 19 15 14 27 32 53 43 29 34
39 29 26 53 18 35 41 45 53 53 53 43 53 57 40 26 43
37 53 42 37 37 19 42 45 53 53 60 53 53 53 53 53 53
40 42 28 7 9 10 14 18 13 20 42 18 28 24 18 5 25
22 20 39 35 24 13 11 9 18 37 35 40 46 24 10 6 6
10 16 15 18 15 12 11 11 9 16 9 10 8 14 9 6 11
9 9 11 9 8 8 11 13 9 8 11 8 13 24 11 10 6
6 6 12 12 9 34 12 11 11 23 19 9 16 21 15 9 10
10 10 12 9 6 10 11 10 14 10 6 10 9 11 12 9 10
11 10 9 12 10 9 10 11 10 14 10 14 7 14 14 12 6
10 9 13 14 20 14 9 10 12 10 11 9 10 9 11 9 20
19 10 9 12 8 9 7 9 8 19 11 6 6 16 12 10 9
9 14 12 14 15 10 10 9 8 11 6 14 7 17 10 11 19
13 16 14 18 32 9 16 11 15 24 6 6 11 11 24 12 17
11 16 10 11 9 6 9 9 11 9 21 7 7 9 9 11 9
11 6 10 8 8 19 6 13 9 10 14 9 6 16 9 16 11
7 9 10 7 14 14 17 9 6 11 10 9 9 9 10 6 10
15 9 14 21 11 10 21 13 17 9 12 20 10 10 10 10 11
11 10 18 12 9 19 12 13 9 11 12 23 10 11 12 9 15
10 9 7 9 11 10 11 11 10 10 9 14 14 11 10 11 17
9 27 20 15 10 8 7 9 6 6 6 10 11 11 8 11 10
8 9 10 9 14 13 14 10 9 12 7 9 20 9 10 10 12
10 10 12 10 10 9 13 13 9 13 13 6 9 11 9 9 11
10 14 13 10 11 12 7 8 10 9 6 6 11 10 7 6 9
13 6 12 11 21 11 10 6 10 34 6 11 16 7 6 10 8
10 11 9 11 7 9 11 22 9 7 11 9 11 13 11 7 6
8 8 7 10 7 9 11 6 6 11 13 6 10 9 9 11 9
12 7 11 7 11 16 9 8 9 9 9 11 9 10 7 11 9
7 11 13 10 9 9 9 11 10 10 8 6 8 9 13 11 6
9 9 9 9 14 6 10 6 10 9 7 11 10 9 9 9 12
11 11 7 9 9 6 9 9 9 13 6 6 8 6 9 22 9
8 9 13 10 13 23 6 9 13 14 14 12 8 8 8 6 12
9 10 9 9 6 7 9 11 10 6 6 6 9 14 10 9 9
13 12 11