S03036-01_C09
Seqid S03036-01_C09
Sequence >S03036-01_C09.phd
CNNNNNNNNNNNNNNNNNNCCAANNANNGGNGATTGGCGGNNNNTCGGCCGAATTGATCC
CGTANANANTAATAAATACTACGAAAGTCTCAAAAAATAATAATGAAATTCTCCACTGCT
TTGTCTGTCGCTTTATTCGCCTTGGCTAAGATGGTCATTGCCAATTCCGAAGAATTCGGC
CTGGTGAGTATCCGTTCCGGCTCGGATTTACAATACTTGAGTGTTTACAGTGATAACGGC
ACTTTGAAACTTGGCAGCGGTAGTGGCTCATTTGAGGCAACTATTACCGATGACGGTAAA
CTGAAATTTGACGACGATAAGTATGCCGTTGTCAATGAGGATGGCTCATTCAAAGAAGGT
TCTGAGAGCGATGCTGCCACTGGTTTTTCTATTAAAGATGGCCATCTAAACTACAACATC
TCTTCTGGTTNCTACGCTATCAGGGACGGGTCGTCTTACTTTNACTCCTCCNAGCCGTCC
GGCGGCACTGCNGGTGGTGAGATNNTTCNNCTATTAAGNGNAGATCTAATGNAGGAGAAG
GGGNCGNAGTTGATTTTNTTTGCTATTAANAAAAAAAGTATAGAAACNTNNNCTTTNCAN
CCCNAGAANNAAGAAGGNANAAAGTCTTANGCNTTCNTATTAACTATAAAAAAANGAGCG
GGNACGCATCCTNATTGNTCTTGNTTCTTCTAGGAANAAAATANAAAAAAACCAANCCCC
CCNCNCCNAAACTACGGGNCNGANAANAATGNTTNATGGATNNNTANCCATTAAACATNT
ANAGGGAGNAACGGGGGGGGGAATGGGAGGGGNNNAGAAGAAGGAGTTAANNAGTAAANN
NNANTNNTNGGCGGGCGNGGANGGGNGAGNNGGGAAGAAATGATGAATTTNANTCNNGGA
ACAANTGTGAGGNTGCANA
Quality >S03036-01_C09.phd
8 7 5 5 4 5 2 2 4 5 6 5 6 5 5 5 7
5 7 11 10 9 9 3 6 8 5 5 8 8 6 17 29 16
15 24 13 12 19 13 6 5 6 6 24 22 19 20 16 13 10
14 9 15 15 9 9 15 9 12 11 21 19 18 7 10 6 10
6 15 18 29 19 34 36 30 17 35 30 27 28 27 12 18 20
26 32 35 35 37 28 16 13 17 10 11 16 22 19 16 31 21
18 21 32 18 15 15 16 20 27 21 27 27 22 22 35 42 27
31 35 35 44 46 43 43 35 47 35 33 35 47 34 35 35 45
43 43 26 46 60 57 45 41 35 40 44 52 60 52 48 52 57
53 57 52 57 52 57 57 57 52 47 57 57 52 57 57 57 57
57 39 48 29 35 48 52 47 52 52 60 48 52 48 52 52 52
52 53 48 52 57 57 48 48 48 53 48 57 53 48 48 57 47
41 48 34 47 37 47 60 28 47 34 35 23 35 35 40 40 36
40 48 45 47 39 39 53 32 53 36 53 31 35 36 30 27 35
52 42 42 47 60 60 48 53 63 57 48 52 57 57 52 53 53
57 60 57 53 52 57 57 53 53 53 53 53 63 63 57 53 60
60 60 53 52 53 57 57 43 53 53 57 58 53 53 58 60 60
53 57 57 52 52 57 57 57 60 53 53 53 53 60 52 53 53
52 60 53 53 53 53 60 58 57 52 53 53 63 60 53 60 57
52 52 57 53 43 53 53 53 44 44 39 53 53 60 53 29 53
37 16 31 28 23 30 30 38 45 44 28 25 23 29 23 27 27
29 53 23 29 35 38 44 35 22 37 38 37 44 53 39 52 52
52 45 42 31 18 23 34 31 19 27 53 53 53 35 25 19 19
43 37 53 53 53 42 53 28 42 38 23 38 30 44 42 37 44
46 34 27 33 28 45 32 11 8 24 9 19 27 34 35 35 19
16 23 19 9 11 6 9 40 22 32 13 42 47 24 34 24 13
11 18 12 13 10 8 30 15 18 13 18 11 13 19 20 16 11
8 19 19 7 9 14 10 16 13 13 18 12 6 9 11 10 10
9 13 11 11 11 10 11 9 9 9 8 8 10 9 9 7 11
9 9 16 10 13 9 9 11 8 8 6 6 9 10 10 6 6
10 20 9 12 17 14 12 8 7 9 6 13 9 12 9 10 9
14 15 9 10 6 10 9 9 18 10 14 9 10 12 10 9 6
13 9 6 11 10 14 11 9 10 10 13 13 18 7 9 11 18
14 17 13 9 10 9 23 11 6 9 9 16 18 14 14 11 10
10 10 12 9 9 10 13 13 9 6 9 6 6 6 9 10 10
8 6 9 8 6 11 28 11 6 9 10 10 11 6 6 12 9
11 10 11 12 9 6 10 6 12 12 10 10 10 9 10 8 10
6 8 11 6 9 9 10 7 12 10 9 14 9 9 11 12 11
9 22 10 17 25 16 23 12 6 11 13 11 10 10 23 11 6
13 11 8 9 9 9 9 9 11 7 10 14 9 10 6 11 11
9 11 9 6 11 9 8 8 9 9 10 14 10 10 9 9 6
11 12 13 11 9 9 6 12 12 10 8 9 10 19 10 15 9
11 6 8 23 15 10 14 11 6 9 6 9 9 6 10 11 11
11 9 10 10 10 9 13 6 9 7 9 9 6 9 11 7 9
9 10 10 6 10 10 6 11 10 9 9 10 9 7 6 6 11
10 6 10 13 9 9 10 10 10 9 12 11 10 6 9 10 6
11 10 16 8 9 10 6 9 10 8 16 10 11 16 14 16 12
9 13 16 9 9 18 11 11 9 9 9 11 10 6 6 6 14
13 13 16 11 24 11 9 11 12 11 11 11 9 10 7 7 8
10 8 8 25 11 6 6 6 6 8 6 9 6 6 11 7 9
9 13 13 13 12 11 16 6 16 10 9 7 9 12 16 6 11
13 11 6 6 11 9 11 11 9 9 14 10 14 9 11 10 10
10 24 16 11 11 11 6 9 6 11 9 7 6 9 10 16 9
10 9 11 6 9 12 9 20 16 10 15 6 10 9 9 18 6
14