S03036-01_C10
Seqid S03036-01_C10
Sequence >S03036-01_C10.phd
GNNNNNNNNTNTTNTNNNNNNCNNNNNAANNGGNGANTGGCGGCNNATCGGCCGAATTCC
CATGGGGATCCGATGAATTTATCACCAACATGTCAAACGACGGCTCAAAAATATTGAATT
ATACCCCAGTGTCTAAAATAGATGAAATAGTTGAAATCTCAAGAAATTTCTTCTTTGAGA
AACAATTGAAATTGTCCCACGAAAATAACCCAAGGAAGAAAGATCTAGAATTCAGGCAGT
TGCAGTTGAAAAAACTCTATTATGCCGTCAAAGATCATGAGGAAGAACTGATCGATGCTA
TGTACAAGGACTTTCATCGGAACAAAATTGAATCGGTTCTGAATGAAACGACCAAACTTA
TGAACGATATACTTCACCTAATTGAGATTTTACCAAAATTGATCAAACCTCGGAGAGTAT
CTGATTCTTCTCCTCCATTTATGTTTGGTAAAACAAATCGTGGAGAAAATATCGAGGGGC
AGTGTCTTGATTNGNGCTGCTTGGNATTTTCCCTTATTTTTAGCATTNGCCCATTGGCAA
AACCCGTTGCCGACGTGACACCAAGGGTCTNGAAACGNGGGTGGATAAGACCCCAAACTG
CTGTTACTATAGAAAGGGGAGGGGGGGCGNGAAGNTTGNTTCTNTTAAATTTAAAANGAA
ANATCGGAAAAAAAATNTTTGCTNCCTCCCNGGNNTGGGNGGANGGGNAGATCCGGANAG
TNNACTCNNACTTCNNTTAAAAAGNNAGTGAGGNGAGACNAGAANAGTTGGTTNAAAAAA
ANTCGAGNNTNNGGGCGTATAANGGAGGAATAGTANTTTTGTCGANATGATGGTAAAGTC
AATACTGAAANCGTATNNGAATAANNAGGNCGAGAAANNNAAGNNGTCGNTAAGTTAGTG
NNGTTCANGTAGNNNNAACTTTNTGAANTN
Quality >S03036-01_C10.phd
10 5 3 4 4 6 4 4 6 8 3 8 10 6 8 7 5
5 7 7 5 8 3 5 3 3 5 15 8 7 5 14 17 6
9 11 7 9 26 12 13 28 19 11 7 7 10 34 19 31 31
26 26 27 22 12 35 30 12 12 12 11 28 38 38 39 35 16
16 22 27 22 44 33 50 44 39 42 42 39 42 38 48 42 52
30 16 22 25 35 47 47 41 42 19 22 41 30 19 20 35 35
46 42 46 46 23 21 35 28 28 29 35 27 26 42 33 41 41
39 32 29 35 37 47 41 52 42 42 46 52 58 52 47 42 47
46 60 57 52 47 52 52 60 52 52 52 48 48 52 60 60 60
52 63 63 57 57 46 52 57 57 52 52 46 46 47 60 46 57
60 57 57 60 53 53 57 52 52 52 48 48 57 57 57 57 57
57 52 48 58 52 63 63 57 57 60 52 52 57 52 52 57 60
52 57 52 57 45 43 42 52 57 52 57 52 57 52 52 60 46
46 35 42 57 44 42 39 52 46 52 52 57 46 52 44 47 34
47 39 34 40 35 28 42 39 34 40 46 39 35 34 46 42 52
60 60 57 60 63 52 47 52 52 52 60 52 60 52 42 47 57
57 52 52 60 57 45 63 52 52 54 57 63 60 63 43 35 57
60 45 52 60 60 58 52 63 52 52 57 57 60 57 57 57 47
57 60 52 46 52 60 60 57 52 47 60 57 57 52 63 40 60
60 58 63 57 60 58 60 52 43 44 60 57 54 52 43 60 57
60 42 35 40 57 60 40 37 35 34 40 35 35 28 40 36 43
57 47 32 35 60 35 37 40 42 52 39 42 42 40 47 60 60
44 60 52 60 47 46 43 42 60 57 57 57 52 39 60 48 48
60 52 52 28 57 52 52 52 58 57 46 46 52 60 48 52 57
60 57 57 52 52 52 42 57 57 52 57 46 60 48 57 43 43
33 48 42 57 40 40 40 43 35 42 42 41 46 57 46 42 46
48 40 47 35 43 42 35 30 28 37 35 19 19 24 11 29 26
27 29 22 23 35 16 28 26 35 35 21 21 13 20 11 13 18
28 15 16 27 16 9 15 35 24 26 24 24 29 24 16 11 6
11 6 9 14 9 9 16 11 9 11 9 6 9 9 8 10 16
14 13 18 18 27 16 10 23 27 20 18 13 11 15 17 27 14
6 11 11 9 11 24 18 16 14 14 9 14 9 9 13 9 13
10 8 9 11 13 10 9 9 8 9 20 18 14 10 19 20 13
11 9 9 9 12 9 14 12 10 7 13 9 9 9 11 10 7
10 19 19 9 10 9 10 10 11 20 11 22 11 12 12 13 12
12 14 20 10 8 13 12 13 14 11 18 11 14 17 12 13 8
16 12 14 9 13 13 10 8 9 12 13 16 36 11 9 9 9
6 11 8 11 11 7 9 9 11 6 11 10 8 10 6 8 9
13 11 11 18 13 9 14 16 11 13 6 9 14 12 15 6 9
8 9 11 10 16 9 19 11 24 12 16 9 9 6 9 11 10
11 9 9 6 10 10 12 16 16 10 7 9 12 6 6 10 14
10 11 6 9 11 9 6 10 10 10 6 9 11 23 12 9 9
11 10 11 7 14 13 10 7 6 10 10 10 10 6 6 12 13
18 10 10 6 6 9 11 10 16 14 11 14 10 6 6 10 17
9 9 12 12 9 6 14 9 11 11 10 6 8 11 10 10 6
12 11 12 11 11 11 15 8 6 10 10 11 13 9 12 14 6
9 9 8 11 9 6 7 8 6 6 9 9 14 13 9 9 11
9 9 9 6 16 11 10 11 19 9 12 14 14 16 9 9 6
9 9 9 18 11 11 11 11 9 6 10 10 9 9 9 12 8
9 14 14 13 9 18 12 11 14 12 13 11 11 9 19 8 11
6 9 9 9 9 9 6 6 9 10 9 10 11 11 6 7 9
10 11 6 9 11 9 10 11 9 10 6 6 6 11 9 9 6
7 9 10 11 12 7 8 10 11 11 10 9 11 14 9 9 6
6 9 19 11 10 9 6 10 9 11 9 6 6 6 6 10 14
11 11 10 8 6 11 11 10 17 7 9 6