S03036-01_C11
Seqid S03036-01_C11
Sequence >S03036-01_C11.phd
GNNNNNNNNNNNNNTNGNAANNAAANCNATAGGGCGATTGGCGGCCAAATCGGCCGAATT
GAAGAAGATGAGATAAGGATTGAGAAACAGTCACCAAGTTTAATGAAAGTGAAATGAAAG
GATTGATTATATAATAGGATAATGAATCACAAAGTATAAAAAGAAGGAAGAAAAAATGAT
ATCATTGAGAAATTGATGAATTTTGAGAAATTGTTGAGATTTAATTGTTGATAAAGGCAA
TAATATTAGGTATATAGAATATACTAGAAGTTCTCCTCGAGGATATAGAAATCCTCAAAG
GGGAATCGATTTTTCTACATAATAATATTACTATTATTCAAAAAAAAAAAAAAAAAAAAA
AAAAGAAAAAAAAAAAAAAAAAAAAAAAAAAANGTCCCGGCCATAAGGGCCAGCTTGAGT
ATTCTATAGTGTCACCTAAATAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGA
AATTGTTATCCGGGTGAGAATTCCACACAACATACGANTCTGNAANCTNAAAGNTGAAAA
GCCGGGGGTGCCTAATGGGGGAGCTAACTCACATTAATTGGGTTGGAGTTAATAGCCCAC
ATCCCCCACGCGAAACGGGGGGGGGAGGGGGGATAAAAGAAATCGTCAAATTTGTATAGA
AAAGGACGATAAAAAAATTGGAGAGNN
Quality >S03036-01_C11.phd
11 5 3 2 2 3 4 2 3 3 4 4 3 3 8 5 9
7 9 9 5 5 9 9 9 5 8 5 12 9 12 9 24 12
13 16 15 13 21 22 11 14 32 21 17 31 10 16 18 35 26
26 31 27 25 28 25 15 27 31 19 12 18 18 30 34 26 25
10 34 40 20 24 26 49 49 30 41 15 13 40 39 31 41 29
35 20 35 30 26 31 39 25 43 43 32 39 31 35 37 27 35
39 44 49 39 33 27 32 28 35 28 31 28 26 42 35 22 24
42 47 25 18 40 47 33 52 52 57 47 57 57 57 60 60 52
44 47 37 52 57 57 52 60 52 44 52 57 60 60 59 59 57
57 52 57 57 63 63 63 63 57 60 57 57 58 58 53 60 52
63 60 60 60 60 53 52 60 52 52 52 58 58 57 53 63 63
58 52 63 63 52 52 63 63 63 63 63 53 63 58 63 53 57
60 57 57 57 60 57 52 60 57 47 60 48 57 52 52 48 60
46 46 46 43 60 57 57 60 60 52 57 57 60 60 52 52 47
60 60 46 40 35 37 42 40 35 42 58 63 57 57 57 60 58
53 60 57 57 57 57 57 57 52 52 63 60 58 57 60 63 60
63 63 63 63 57 58 57 57 52 63 48 46 54 57 58 60 63
63 52 52 57 57 60 63 60 57 60 58 58 60 60 58 52 52
52 57 52 45 60 63 60 49 60 49 60 60 47 54 47 51 49
49 49 49 54 50 50 54 58 49 51 54 50 60 47 47 47 22
36 39 22 12 19 15 18 22 22 22 22 22 18 22 16 22 22
25 27 22 12 15 15 11 9 11 12 12 13 15 19 13 14 16
15 16 15 19 26 9 9 24 26 42 16 21 17 17 16 9 12
9 6 13 19 16 37 35 21 15 23 18 14 20 22 44 43 28
17 29 28 16 13 18 26 32 28 19 24 24 17 27 19 28 17
19 22 22 21 21 28 12 31 14 36 24 13 26 35 21 19 22
19 30 23 19 27 32 22 27 25 32 30 25 30 17 16 32 35
14 16 14 21 17 17 25 18 24 27 32 12 29 18 8 27 21
21 15 17 28 32 14 21 21 18 14 10 13 12 16 14 15 10
9 12 10 12 14 28 17 27 27 24 19 14 23 16 17 19 18
11 21 30 24 18 23 11 7 8 12 9 11 6 27 15 7 18
8 7 9 10 20 8 7 9 21 16 27 19 11 9 14 12 12
14 27 23 31 19 27 31 39 16 28 31 26 14 10 12 11 26
12 11 16 11 15 21 33 18 14 15 18 12 12 8 11 18 11
17 13 9 11 11 32 12 27 8 24 14 8 11 25 8 11 11
11 22 11 8 9 9 14 11 23 34 14 14 10 16 10 13 18
22 23 10 11 8 10 19 18 13 24 32 32 18 10 34 15 11
13 28 13 9 11 10 13 14 12 11 32 40 12 27 24 20 13
17 14 27 14 12 15 14 11 12 17 11 11 11 20 25 32 33
17 10 10 10 11 21 11 12 9 10 16 11 15 22 14 12 14
22 14 10 11 11 6 6