S03036-01_A07
Seqid S03036-01_A07
Sequence >S03036-01_A07.phd
NNNNNTNNNNNTNNNNNNNCNNNNNNNNNNGGCGATTGGCGGCCAATCGGCCGANTCCCA
TGGGGATCCGATATCAAGCTTGGGCCCGGTACCGGCCATAAGGGCCAGCTTGAGTATTCT
ATAGTGTCACCTAAATAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTG
TTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGG
TGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTC
GGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTT
GCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCT
GCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGA
TAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGC
CGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACNAGCATCACAAAAATCGACG
CTCAAGTCAGAGGNGGCGANANCCGACANGACTATAAAGATACCAGGCGNTTTCCCCTGG
NGNCTCAANCGTGCGCTCTCCTGTTNCGACCCTNGGCTTANCNGATACCCGTTGACCGNT
ANNATTAANNNANNGTNANCNTTGTNAAAGCNCAAGAGGGGNNATAAAACAANTAGATGT
NNATNTNNCNANAAGANGGGGGGGGGGCAAAGAAACAAGAGACCCGANCNGNAAACATAN
CNAGAAAAACANAACNCTCTCCGCNAGTGGGGGGGGGGAAGAGNGGGGGAAAAATGACCT
TNTNCGTTNACTN
Quality >S03036-01_A07.phd
5 2 3 2 2 10 6 3 3 3 3 11 5 6 5 4 3
5 7 9 5 7 5 7 5 5 3 3 5 7 14 26 15 24
27 12 25 31 10 10 34 24 11 16 21 37 42 28 42 31 30
42 31 17 6 20 21 29 30 21 41 43 47 46 46 16 14 34
31 41 41 29 42 33 28 29 26 34 50 50 50 43 50 34 40
50 44 49 51 37 18 30 49 50 38 49 41 26 49 49 49 43
52 38 44 50 26 49 49 49 50 50 42 44 43 36 38 50 52
50 51 51 52 51 52 53 52 49 37 42 51 52 51 52 52 52
43 52 52 52 52 52 42 52 52 50 52 52 52 49 49 53 53
53 53 57 54 54 57 57 53 57 57 57 57 57 49 57 57 57
50 57 57 57 57 53 53 47 57 57 57 50 54 54 57 57 53
57 57 51 50 54 54 57 53 53 53 50 42 59 54 57 54 59
54 54 57 57 57 57 57 54 57 57 57 57 53 49 50 59 59
59 54 57 53 53 53 53 49 49 43 43 51 49 43 43 53 53
53 53 54 57 50 57 57 49 53 51 57 57 57 57 59 57 54
53 50 49 54 51 51 54 43 57 54 59 57 54 59 57 59 57
50 57 57 57 57 50 57 57 57 59 59 54 57 53 43 53 57
59 59 59 53 45 49 57 44 57 57 59 54 53 53 57 53 49
39 57 57 57 54 54 59 54 57 54 54 50 59 59 57 57 59
59 49 43 46 46 49 53 45 51 54 54 50 50 50 50 54 57
54 54 57 54 54 50 46 51 57 42 28 45 44 52 39 54 50
54 57 57 50 33 57 54 54 50 57 54 59 52 42 50 50 50
50 54 54 42 49 50 50 51 49 42 45 45 49 49 49 50 54
54 38 49 50 42 34 54 54 54 54 57 59 59 50 59 59 54
54 57 54 54 54 50 51 54 50 57 46 57 54 54 42 50 42
54 50 42 43 50 51 43 54 43 43 54 54 49 45 43 59 54
50 50 42 53 49 54 54 43 49 54 43 49 54 37 47 36 32
39 32 49 40 35 35 50 21 49 32 32 46 40 36 35 28 30
42 30 49 35 26 32 46 42 31 37 30 27 40 22 15 31 29
29 49 32 40 35 39 37 46 43 17 46 40 42 49 47 27 39
12 32 29 28 36 33 30 31 35 26 39 14 30 27 24 49 39
49 22 33 35 28 39 37 21 37 40 26 45 19 45 38 31 43
40 40 35 32 32 43 46 26 35 35 34 22 31 39 17 40 11
35 28 11 46 25 37 31 29 27 31 15 15 31 41 35 35 35
25 10 7 13 11 9 15 28 24 30 22 43 42 33 16 17 20
26 10 12 19 9 27 17 11 10 11 10 19 15 15 11 27 12
13 7 23 25 19 9 9 7 8 7 15 12 12 27 13 9 6
8 12 21 13 17 15 19 18 23 12 27 23 35 19 15 9 9
35 9 10 6 13 15 8 12 13 17 35 31 19 14 7 9 7
19 12 9 8 9 6 9 10 12 19 13 13 22 18 19 10 18
29 24 13 9 10 7 13 11 18 11 14 16 9 6 8 9 12
11 11 9 6 9 5 13 29 11 13 9 11 10 13 10 8 11
10 9 8 8 6 9 8 6 6 9 11 19 11 11 6 6 6
13 6 6 11 9 6 8 6 10 6 23 17 11 11 7 22 10
11 9 10 6 9 13 11 9 8 11 10 10 10 6 6 9 11
17 10 11 9 9 14 9 6 12 9 10 8 14 11 11 6 6
11 9 6 14 7 6 9 7 10 7 9 9 9 10 6 11 14
9 10 12 19 14 11 11 17 12 10 11 19 11 11 8 11 18
14 11 8 8 9 9 11 11 10 8 28 6 9 6 9 6 11
9 9 9 14 14 17 7 11 6 8 8 10 18 11 18 13 18
10 6 9 9 11 7 11 10 11 8 9 11 10 11 7 12 9
11 13 13 23 15 14 12 19 12 21 13 11 18 14 10 11 6
9 11 10 9 8 9 13 13 15 17 9 10 16 10 15 11 9
6 8 6 13 8 9 9 6 11 8 9 6