S03036-01_C14
Seqid S03036-01_C14
Sequence >S03036-01_C14.phd
NNNNNNNNNNNTNTNTNGGGGNNNNNNNNNNGGGNGATTGGCGGCCAATCGGCCGAATTG
GCTAGAGACCTGAGTTTGTCATTTGTTTAGTTCAAGGATTAAATAAACGATCCTTCTACA
AATAAGTCCTTTCTTTCACCATCGTCTTAAGACCACTGCCTCCTACGAAAACTAACCTAA
AAGAGTTTAGATCACGAGTATTTTCGCTCTTTCCCTCCTTCCCCTGGTTTTTTCTCGTTA
GTTCTTTTCATTTAAAAACTCTTCTCTTGTCAAGAATTTAAAAGACGAAGAGTCCAACAC
CGACTGATTTTCTAACAGCAAAGGAACGAAGTTTTGCCGTGCAAACAATAATTTCTAAAT
TATAATTTTGAGCCTAGCTGAGAAATAGGAGAGATTATATTTTAGAAAGGTAAGAAGTTT
TTCTGTCATTCCTTTTAGAATATTTGNTACGTTCTAACATTTTTTGTTACAANNAGCGAN
TTNNGTGAAGCGACCGAGTAGAAAGCTAAAGGGTGTTANNAGTAATCGATAAAAAGTAAA
ATGTAAGGNNATCCAATACTNGAATAAAAGTNANAAAATGCNGAAACACTTNAATNATNT
TTATACGCAAAAGAAAGAGNGGGGGNTAGAAAAAAGCTTGAATTAGGTGNNGGGAGCCCG
GGGGCGGAGCCACGCCTAACGATAGTTGGAAGTGGGGTTTGATGTGGAANNNAACGTANA
AAACCATAAGANNACAAGACCCCGGCGTAAGGGGTACGGGGGGAGGGGGGGGGGNAAGGG
GAATAATAAAANGATAACCNCAGGCAGTACAGAAAAAAAANAATNNGTGTTGCGGANACA
NAAAAGAAAANNNAAANTAATNCAATTTAANAAGANNGNGNGNTANNNNAAGCAGANAAA
AAGGTNGNGNNAGTGNCAGATGGACGGANNNANA
Quality >S03036-01_C14.phd
4 3 4 4 4 5 5 5 3 3 3 10 6 10 6 10 3
14 10 22 14 7 6 7 5 7 7 5 6 3 5 11 19 8
6 18 21 15 17 23 12 9 27 14 9 14 10 9 28 20 25
29 24 28 27 29 9 38 21 23 11 15 33 24 35 39 44 20
18 35 40 52 32 20 31 19 20 38 29 16 32 45 44 44 48
28 27 16 16 30 45 53 53 34 21 53 45 18 16 21 24 24
42 53 36 40 32 53 42 42 27 41 38 27 42 53 41 40 53
25 33 36 42 42 42 44 53 53 60 53 53 46 53 53 53 53
53 53 52 52 46 53 57 53 53 53 53 53 60 53 52 63 52
63 57 53 53 58 60 60 52 57 53 52 57 57 52 52 57 57
52 53 52 53 60 57 57 52 57 57 60 57 58 63 60 57 63
58 58 53 60 57 52 60 52 53 58 52 52 60 52 60 60 60
53 52 52 53 57 60 60 52 57 60 52 52 58 60 57 52 57
60 60 53 52 53 53 45 60 53 53 47 53 53 42 52 53 42
37 35 53 33 23 30 35 44 44 53 53 45 53 57 52 52 57
57 60 57 53 60 60 53 53 60 57 57 58 57 60 60 52 60
52 60 58 52 53 60 52 57 53 60 57 53 53 57 52 52 53
37 53 57 52 52 53 45 53 53 53 52 60 52 48 48 53 53
53 53 53 53 53 53 53 53 53 53 53 53 57 57 39 15 39
53 43 39 53 57 53 30 43 53 53 53 53 53 53 53 53 44
53 53 39 53 53 60 28 37 28 27 27 37 39 30 30 23 38
23 22 23 35 42 42 27 23 37 53 38 38 53 53 52 53 52
57 53 52 53 60 53 53 42 52 53 44 38 28 18 28 53 53
43 30 53 38 30 30 45 39 53 38 35 26 37 30 37 37 22
53 52 39 21 44 47 43 28 37 33 30 13 16 13 20 35 30
25 35 18 25 19 35 35 27 23 35 33 31 20 13 11 11 14
23 23 18 21 6 11 41 18 18 23 23 24 18 9 9 8 8
23 24 41 40 28 11 9 9 9 20 13 10 11 6 6 9 24
16 10 13 7 11 19 6 6 9 9 23 10 15 12 14 9 9
11 10 10 10 11 19 11 12 11 11 13 13 11 11 17 8 9
22 11 11 10 9 20 14 11 6 7 11 22 9 13 10 8 14
16 19 15 17 15 13 18 15 13 14 16 14 15 9 10 14 11
14 17 10 9 6 7 11 15 15 16 17 26 12 11 9 10 7
14 20 11 16 18 12 14 12 9 18 7 14 7 17 11 11 10
14 28 14 7 9 9 10 14 14 12 11 11 9 7 11 10 12
6 9 10 6 10 19 10 8 12 11 15 14 13 12 11 9 15
11 9 10 12 16 17 16 7 10 11 11 10 14 7 9 12 13
11 12 13 11 9 10 16 11 14 13 28 11 11 20 9 15 11
14 13 9 7 6 11 14 20 24 15 11 8 14 28 18 11 9
10 10 8 12 14 10 10 15 16 13 22 10 10 9 14 13 15
20 16 11 28 9 11 11 18 17 12 19 16 9 11 9 11 9
12 20 9 9 15 9 9 14 10 14 10 13 6 6 6 11 9
10 11 14 11 6 24 25 17 11 15 10 13 13 19 18 14 10
6 7 11 10 9 9 11 11 9 9 11 11 12 13 11 12 9
9 16 11 13 14 12 9 14 8 11 12 24 9 27 32 10 15
12 12 11 24 14 10 13 14 9 6 9 18 11 13 11 22 15
12 9 23 14 9 18 10 17 11 6 21 12 8 10 14 8 9
6 10 19 10 9 8 12 14 9 9 9 10 9 10 9 9 23
21 14 14 18 6 9 11 11 6 6 9 9 18 11 10 11 14
19 11 11 6 11 11 9 6 14 11 9 11 9 14 8 9 11
6 6 6 23 14 9 6 9 10 13 10 7 10 12 14 9 19
9 10 11 6 9 9 9 10 6 6 9 6 9 6 10 6 11
10 6 6 6 7 11 10 13 9 10 11 11 7 12 13 9 9
10 15 9 12 7 9 7 9 6 6 9 11 10 8 6 8 9
9 15 10 10 9 9 10 18 10 10 6 6 6 10 6 9