S03036-01_C15
Seqid S03036-01_C15
Sequence >S03036-01_C15.phd
GNNNNNNNNNTNTTNNNGCNNNNNNNANNANNGNGATTGAGCGGNGNTTCGGCCGAATTG
NNGCAACAAGAACATAAAAAATTGTTTTTGCTACATTGGTTTCACATAACATATTTCAAC
AAACATGCCATCAAATTTGAATATAGTGAAGGTTACAAAACCACAAGAAGAAAATAAGAA
TATTTTACACAAAAACACGAATGAACCCAATGAAATGGAACAATCGCAGACACAAGAAGC
AGTTACAGAAAATTTTACCGAAAACAGTAATCTCAGTGCAAATGAACATGCAGCTAGGAG
GGGTAGATTAAATTTGAAAACAGTTGATCACATAGAAACTTATCCAATAGTGCAAGAAAC
AGAAGAGATTGCAAAAAAGATTGCTCTAACGAGAATTATTTTAGCACAAACAAAGCCTAG
AATCGATAAAGTGGTAGTGTCACGTCCCGTTCAAGCCGTAGCACCAGTGGTCAATTTTTT
TGACAAGATGGCCAATTCGACTTTAAGTACAGTAGAGCGCGTTGTCCCTTCTTTGAAAAC
AAAAACTTATAAAAGATTAGGTGAGGAAATTGCACTTCCGTATACTTTGTCGAAAAANTA
TGGAAAGCAGCTCAAGGATACNACAGCAAGAAATGGAAAAAACTATGTTTACCAACCTGT
CCATGGAAGGGTTGATNAAATTTAGGAAGTACTATAATTAAAAATTTATAGNCNNANAGG
GCANAACCTAGATCACCGAGCCACTCGAAGAGGGTGAGTGAAGGGAAANAATACATTTTA
TTCTTTAACAGTAANNNNTACGNAGCAGNGAGAGAGGGNGNGAATGNNTCANTTNTTGNN
AGTNNNNNNGCNNCNACCTCTCANTNCGANNTGCGGCANGGGGGAGGGGGGGAGNNTAGN
GTNNNNTATGTGTTTTTGANNG
Quality >S03036-01_C15.phd
11 6 5 6 2 4 6 6 3 3 11 4 12 11 5 4 5
8 8 7 5 5 5 5 5 3 8 6 7 8 7 7 8 5
12 22 10 14 16 8 15 9 22 17 7 9 6 8 23 17 23
24 25 17 13 15 12 21 21 14 7 7 11 16 20 23 28 19
31 28 22 19 19 21 29 38 42 49 45 40 27 20 36 42 32
36 35 35 32 31 28 28 27 41 26 32 32 29 17 17 26 25
35 27 44 30 32 21 23 27 21 23 24 27 22 27 28 27 25
34 26 35 39 39 30 38 44 43 33 33 44 47 35 39 42 47
43 46 49 44 44 60 60 46 47 60 60 60 52 60 52 63 57
43 57 47 52 57 57 52 52 52 57 57 57 60 48 48 57 52
58 57 43 43 53 57 52 60 57 52 52 52 52 60 60 52 57
57 54 52 52 57 60 60 63 57 52 57 57 63 63 63 63 63
57 52 60 53 52 57 57 53 52 60 57 52 58 57 58 57 57
57 57 60 57 57 57 60 52 52 44 44 43 32 47 53 43 44
44 53 35 44 53 44 27 29 35 57 52 60 53 53 53 63 63
53 60 52 60 60 52 57 60 57 60 52 57 57 60 57 57 57
53 53 57 63 63 60 57 57 60 63 53 63 58 53 53 53 58
57 53 53 57 52 52 58 63 63 52 53 63 60 58 53 60 52
52 53 53 57 57 52 52 53 58 57 53 53 57 63 60 57 60
57 57 63 48 53 57 57 60 52 57 57 52 52 57 57 57 53
43 43 53 53 53 52 57 57 52 57 53 52 60 60 57 57 52
60 53 53 35 35 37 35 60 57 53 48 37 45 52 57 60 60
60 60 60 53 60 52 48 48 48 52 57 57 43 43 48 57 53
57 52 52 52 46 53 48 52 63 53 43 43 43 48 57 53 60
52 53 57 57 57 48 48 57 57 60 57 52 63 57 57 57 57
58 57 60 57 57 52 57 57 52 52 48 48 57 57 40 43 46
42 40 48 52 40 47 60 60 60 52 39 57 52 60 43 40 60
48 32 43 40 31 48 30 43 34 48 43 30 46 40 48 47 58
60 43 43 53 60 46 42 44 22 41 36 15 25 47 42 24 41
40 60 40 43 40 46 52 34 47 44 57 47 57 40 52 57 60
35 43 60 49 47 60 35 49 50 59 54 47 47 42 31 35 38
33 38 33 38 27 32 43 47 35 47 47 49 27 36 46 49 49
46 43 38 43 49 39 26 49 49 45 35 43 21 47 49 36 44
39 35 32 18 42 39 37 42 33 54 30 21 21 21 39 46 29
38 34 30 33 35 24 26 24 24 50 35 19 22 24 33 47 49
46 28 6 28 32 26 27 27 24 32 31 32 30 22 21 26 29
28 14 8 25 32 24 21 16 13 7 19 17 28 38 29 29 30
25 37 35 30 13 31 21 16 15 11 9 9 9 11 13 22 20
15 27 26 17 12 11 9 19 28 22 28 28 21 18 9 17 21
30 22 19 31 37 13 30 13 21 10 18 12 16 6 11 14 15
19 19 13 14 17 16 14 12 21 12 11 15 16 10 14 11 11
14 14 11 16 17 13 20 28 22 11 16 16 18 12 6 9 6
6 10 6 21 14 27 20 13 18 6 19 11 18 10 12 11 10
10 10 11 20 17 11 18 11 21 16 10 13 15 12 8 12 8
11 10 13 22 19 16 12 9 9 16 14 13 12 9 10 15 11
9 9 12 7 14 22 9 9 9 12 24 18 19 18 11 10 15
10 13 10 11 10 16 11 13 9 13 26 10 6 6 6 6 12
13 13 18 6 19 10 11 22 26 5 19 17 11 9 12 16 29
27 15 7 10 6 9 16 16 12 12 6 6 10 8 9 6 10
10 6 10 11 12 7 6 10 9 8 6 6 5 5 6 7 16
10 7 7 13 7 12 9 10 16 12 9 9 12 6 9 6 16
14 10 6 6 9 9 10 11 14 11 11 7 10 11 14 12 15
14 31 16 10 12 11 16 19 12 21 6 6 9 12 8 7 9
11 7 6 6 6 12 11 29 18 14 11 20 13 11 13 11 10
18 6 7 12