S03036-01_C18
Seqid S03036-01_C18
Sequence >S03036-01_C18.phd
NNNNNNNNNNNNNNANNGNNNCNNNNNNANANGGCGATTGGCGGCCANATCGGCCGAATT
GGAGATAAATTTCAAAGAAGCAGGAAGCAAAGGATGTTTAGTAGAATTTGTAGCGCTCAA
TTAAAGAGGACGGCATGGACCCTTCCCAAGCAGGCTCACTTGCAATCACAGACGATTAAA
ACATTTGCCACAGCACCTATTCTGTGCAAACAATTCAAACAAAGTGATCAACCAAGACTA
AGAATAAACTCTGATGCTCCTAACTTTGATGCTGACACAACGGTTGGTAAAATCAATTTT
TACGACTACTTGGGCGACTCTTGGGGGGTCTTGTTTTCTCACCCAGCAGATTTCACCCCT
GTCTGCACCACCGAAGTCAGCGCATTCGCCAAATTGAAGCCGGAATTCGACAAGAGAAAT
GTTAAATTGATCGGGCTTTCAGTGGAAGATGTTGAGTCCCACGAAAAATGGATTCAAGAC
ATCAAGGAAATAGCAAAGGTTAAAAATGTTGGTTTCCCAATAATTGGTGACACTTTTAGA
AACGTGGCATTCCTATATGATATGGTAGATGCCGAANGATTCAAAAATATCAATGATGGG
TCACTGAANACCNNGAGGTCTGTTTTCGTCATCGATNCCAAGNNNANNATTAGACTTANT
TANACCNACCCTTCCACCGTCGGAANTNACACTTCTGAAGTGTTAAGGGTNATTNNANGC
CATGAAGCAGAANNGCCACCCCNGCAGCACAACTCAGANGGGTTGACAGGGGGGTTNAGT
TATTNNNNNNNNNGNGTATAAGTNAAACACGNNCATCNAGTAGNNTCATNNATNANAAGT
ANTTTANACTATNAAATTGNCTTCCNNCCTNGGCCTAGGNNCAGNCNGANNNNNGNNGGT
ATNNAN
Quality >S03036-01_C18.phd
5 5 3 3 3 3 2 4 4 4 6 6 3 5 9 5 5
11 6 7 5 11 5 5 5 5 5 5 16 5 8 7 13 15
9 19 20 14 27 22 10 12 26 22 16 13 9 7 15 36 26
31 25 38 40 41 30 12 23 30 22 14 26 22 13 10 23 30
29 28 49 38 28 21 26 36 42 43 37 32 35 30 29 35 25
27 36 36 26 25 34 36 49 25 20 50 42 42 28 26 26 26
29 27 50 47 29 46 46 47 35 32 37 42 43 38 41 46 46
42 59 46 38 37 37 43 50 45 46 31 30 49 43 42 39 49
50 42 34 42 50 49 51 50 54 54 50 42 46 46 50 54 50
53 51 51 47 46 42 53 53 53 50 46 43 51 54 59 59 51
50 42 50 54 57 51 50 49 49 49 54 54 50 50 57 51 51
54 42 50 49 50 50 52 50 51 53 53 51 51 52 57 53 53
53 53 53 46 53 47 49 54 54 54 54 50 43 54 54 50 42
43 46 49 54 54 44 44 49 50 54 50 50 36 37 24 29 27
29 35 32 25 30 29 33 26 38 36 42 50 54 49 50 45 46
46 46 50 54 50 50 43 59 54 49 53 45 44 34 44 51 54
54 51 45 50 46 50 42 57 57 57 57 49 53 53 53 54 54
57 53 51 50 57 54 53 49 53 57 57 57 50 50 49 51 54
50 54 57 54 51 51 57 57 43 50 57 38 54 54 59 57 54
57 57 57 57 57 42 57 54 57 57 54 59 59 57 54 54 54
42 50 46 44 36 46 49 43 44 42 36 46 46 49 36 50 49
46 43 43 49 39 35 35 49 46 32 33 40 49 40 49 52 57
52 42 52 54 54 59 50 49 49 49 49 49 50 42 45 45 40
45 49 49 51 49 54 54 54 50 50 49 53 51 49 42 50 54
43 50 43 43 53 42 57 35 53 47 50 38 57 42 49 50 54
49 49 51 49 50 50 54 54 49 49 49 49 53 53 42 33 49
50 49 46 42 42 40 42 32 50 35 51 54 50 42 50 49 46
46 46 49 49 42 19 22 41 43 39 49 40 38 28 40 33 8
20 39 38 39 24 43 42 27 33 41 31 15 17 25 31 26 24
17 22 29 31 29 43 15 20 37 37 37 40 43 43 49 33 40
45 40 43 49 40 26 27 27 37 38 34 25 37 21 21 37 29
28 31 33 25 39 42 50 46 33 25 32 19 53 34 26 30 21
29 40 43 42 32 28 40 35 43 31 42 34 35 35 42 46 20
20 13 39 27 25 46 26 40 24 20 37 35 12 17 9 5 20
13 21 37 23 13 13 37 37 20 18 25 19 16 29 27 33 37
30 26 42 19 18 12 20 12 18 24 19 17 14 7 20 26 20
7 7 10 13 15 20 8 13 9 24 8 14 11 15 12 19 10
10 12 18 11 19 15 10 6 18 15 9 13 13 6 6 6 13
7 6 19 8 18 17 10 22 18 17 10 12 7 21 15 9 6
9 11 11 6 9 8 11 10 14 17 11 12 17 28 28 21 19
21 11 22 28 36 7 8 6 12 18 21 18 21 29 22 21 18
13 12 12 19 18 12 12 21 21 27 14 11 9 6 10 10 9
7 6 16 7 9 9 9 9 16 9 9 10 9 9 9 9 14
9 6 6 9 14 10 12 10 10 10 9 6 11 17 10 11 12
8 10 9 18 21 10 10 10 11 9 6 9 10 11 9 11 11
9 8 10 11 17 9 9 12 11 15 11 6 15 9 8 9 9
12 19 6 6 6 6 6 6 6 7 6 9 6 10 9 12 9
13 10 10 8 6 11 18 11 12 11 8 9 7 6 9 9 9
8 7 11 9 11 8 9 6 6 9 9 9 9 7 6 28 10
7 22 6 14 11 11 9 10 7 11 9 9 12 6 9 22 10
10 13 6 9 10 9 9 10 9 7 9 9 9 11 9 6 6
9 9 9 6 11 13 10 14 11 9 14 10 6 7 10 8 10
7 11 7 9 9 6 6 6 6 6 11 6 6 8 11 13 11
9 7 7 9 6