S03036-01_C20
Seqid S03036-01_C20
Sequence >S03036-01_C20.phd
NNNNNNNNNNNNNTNNNCNCNNNNAAANNNNCGATTGGCGGCCAATCGGCCGAATTGGTA
GAACGAAGGTAATAAATACTATCATTATTACTATAGATATACAATGCTGTCTGCACGTTC
TGCCATCAAGAGACCCATTGTTCGTGGTCTTGCGACAGTCTCCAACTTGACTAGAGATTC
AAAAGTCAACCAAAACTTATTAGAAGATCATTCTTTTATTAACTACAAGCAGAATGTGGA
AACGCTGGATATCGTAAGAAAAAGATTAAACAGGCCATTTACATACGCGGAAAAGATTTT
GTACGGTCACTTGGATGACCCTCATGGTCAAGATATTCAGAGAGGTGTTTCATACCTAAA
ATTAAGACCAGATCGTGTTGCCTGTCAAGATGCTACTGCTCAAATGGCTATTTTACAATT
TATGTCCGCTGGTTTACCACAGGTTGCTAAGCCAGTCACTGTCCACTGTGACCATTTGAT
TCAAGCACAAGTTGGTGGTGAGNNAGATTNGAAGAGATCTTTANATCTAAACAAGGAAGG
TAANGNAGTTCTTGGTCTCTTCCACTGCTAANNTAACGATGAGATTTCCGAAACCAAGCT
CCCGGCCCAGGCNGAAGNAGTGGAGGNGAGGTATTTTTTGATATGTACTTTGAACAAAAG
AAAAGNAATACCCGCCCGGACAGCGGAAAGGTGGGGAAAATAGNNTATANAAAAAAAAAA
AAAAAAATNNNCAAAAAANNNCGCAGGGGAGGGAGNGAGAGTTTTAAAAANNNATTATAG
AAGATCGAGTAAAAAATGTNAAAAGANNAGTAATAGAACTCTATTCTCTCCTCACNATGC
CACTATCNNNA
Quality >S03036-01_C20.phd
5 2 2 3 3 4 2 5 6 7 7 7 5 12 5 5 7
9 6 10 6 6 6 5 10 9 8 5 5 3 7 9 24 30
14 30 42 25 24 34 30 13 20 14 16 32 36 36 32 35 40
32 41 10 26 40 36 31 37 37 40 42 28 27 37 39 37 28
39 43 37 46 31 46 46 49 43 49 50 54 54 50 38 33 42
29 42 44 54 54 54 44 44 50 44 47 44 47 47 54 47 50
44 42 40 60 42 39 38 32 40 47 52 47 34 46 57 57 46
57 60 52 57 52 52 57 52 47 57 52 54 52 48 52 60 52
52 58 63 63 63 63 63 60 63 63 63 57 58 60 63 63 63
60 52 57 63 63 63 63 58 60 58 52 63 63 63 63 63 48
52 63 58 54 58 57 52 52 63 63 57 58 63 63 63 63 63
57 63 63 63 49 63 63 63 63 57 52 50 57 58 63 60 63
63 54 57 44 49 50 50 49 60 60 60 60 51 57 57 63 57
60 63 63 52 57 50 49 49 47 60 50 49 42 44 52 63 63
49 49 49 49 50 54 63 63 51 63 52 50 54 50 54 54 54
60 60 50 58 54 59 63 60 60 45 44 58 59 59 63 63 54
58 63 50 52 50 54 63 57 60 60 50 63 63 63 57 60 63
63 58 60 60 60 50 45 44 63 63 63 58 50 54 54 50 58
60 54 54 50 51 58 58 57 45 47 50 45 35 60 49 49 50
50 50 63 54 50 50 47 47 60 50 35 54 50 60 42 31 47
49 47 44 44 47 47 50 42 49 49 60 60 54 47 50 60 50
50 60 34 34 42 47 47 44 43 50 42 47 50 59 54 54 63
58 60 63 50 60 49 50 60 60 60 54 50 44 47 60 45 44
49 51 50 50 54 60 60 60 50 47 39 63 58 60 54 60 47
60 50 44 50 49 43 33 42 39 49 42 60 42 42 47 50 54
50 50 47 44 47 50 49 60 51 51 44 47 47 42 60 49 42
58 42 60 60 42 44 50 47 35 35 42 60 28 27 24 35 42
42 47 39 42 35 18 40 47 44 24 47 31 35 42 39 42 20
20 35 32 38 42 21 10 21 31 16 17 16 21 17 15 12 14
36 44 31 22 20 9 24 12 9 6 6 22 12 35 35 11 7
10 27 22 9 12 10 16 9 13 11 9 16 15 6 18 22 14
14 25 27 18 20 44 23 11 31 21 41 9 22 12 13 9 7
13 7 22 8 21 19 21 16 16 16 10 11 19 21 17 9 9
11 8 10 15 17 15 11 9 21 16 7 7 13 20 17 17 10
25 13 14 13 8 12 15 11 10 10 10 16 19 22 11 16 18
14 10 14 20 22 31 17 17 11 13 11 11 10 14 13 12 11
7 11 11 14 10 7 9 21 11 11 22 14 17 18 7 11 18
12 11 10 9 10 14 15 20 11 15 10 14 22 11 9 10 25
11 13 13 14 14 12 14 17 14 19 27 17 17 21 21 21 14
9 11 7 10 14 8 13 9 16 12 19 13 10 15 13 14 15
10 20 18 14 16 11 8 8 11 16 8 14 15 9 12 13 18
14 14 15 9 11 10 6 7 12 17 8 10 7 11 20 12 14
14 9 17 13 19 13 9 10 9 22 9 9 12 8 7 6 6
9 8 10 11 9 12 9 7 7 7 9 14 8 8 11 18 20
15 9 23 17 13 8 10 6 10 13 14 8 12 9 12 13 14
11 18 8 19 14 7 7 6 11 11 13 13 19 17 18 19 16
12 28 25 13 8 8 8 10 8 17 14 14 16 17 20 9 9
6 16 10 13 20 19 15 7 6 16 9 10 11 14 13 16 11
16 12 16 11 16 13 15 14 8 17 14 29 13 16 14 14 8
13 8 7 13 8 11 11 11 17 11 17 12 13 11 7 6 6
11