S03036-01_C21
Seqid S03036-01_C21
Sequence >S03036-01_C21.phd
NNNNNNNNNNNNNNNNNNNNCCNNNNNNNNAGGNGATTGGNGGCGGATCGGCCGATTTGT
GGANCAACAACAGCTAACGAACGACTAGGTCTCTAAGAGAAAAAATCTTTTTCTTTTCAC
AACATGGAGCAAATATTATATAATCAAAGCCTTAAAATTTCTACCCTTTCTACTTTTCAA
GGTTTAAAGTTTCTAAAGGTCCTCATTTTTTCTATTTTCCAACAACTTTTTTATAACCCA
GTTATACAATTATTCGGAACGAAAGCCTCAATAATGGAATCTGATTCCACTACTCTGCTC
GAAAGTAGTTGGAGTACTGAGCGAAACTTTCTCAATATGAATCCAGATTCCATATCTGCT
AGCAAGAATGTTTTTATATTATTTTTTACCATTTTCAGATTAGCGGAGTATATTGTATAC
AAACTCTCTGACCAGAAGTATCGGTTACACACATCCCTGAGNGTCCAACATTTCAGGNGG
AATTCGAAGAAGAATACAAACANAANNTGGANACTTTCNTTTGGAANGCTTACTTAGAAG
AGCANTATACTGNCGATTTATGTAGCCAATAGNNTAANAATTNNGACCNNCCGTCCCTCN
CNGGNGGGGGGGNAGGGAGAACGAGAAAAATATNTNTAGGGACGATNAGNTNAGAAAAAN
AAAAGAAANAAGAGCAAAGAAGGGAGGGAGNAAGGTNAAAGGGAAAAGAAAAACTANTCC
TTCGGCCAGGGNTGGTGCGGNNTNNGAGGGGGNATGNTTNAATTTTTTATNGGGTGNTTA
CNNGAGGGGGGAATNNAGNGTGGACTAAGAAGAAGAACGGANANGGANNNGNGGGGNNGA
GGNGNNGNGANGGGNNGAN
Quality >S03036-01_C21.phd
5 2 3 3 3 3 3 2 3 4 3 5 3 3 3 6 4
6 7 6 12 11 7 5 3 7 5 3 5 7 10 14 8 3
10 12 16 13 31 11 6 28 24 8 9 9 10 22 24 37 29
16 23 27 22 9 29 26 25 24 34 12 8 5 25 14 20 26
19 22 30 28 38 31 28 31 35 22 31 23 29 30 31 20 30
32 36 37 43 41 37 41 31 30 22 28 26 41 29 30 30 30
29 32 34 35 32 26 29 30 34 35 40 37 46 46 46 28 26
35 33 27 42 36 51 47 42 30 47 46 35 31 46 49 43 44
42 46 49 46 54 43 54 50 39 25 40 46 54 50 46 46 45
41 37 37 43 32 43 47 46 44 50 49 49 49 49 49 49 46
44 42 44 51 47 43 46 44 32 41 43 43 46 43 44 60 51
43 63 49 58 43 43 47 50 49 47 60 63 52 57 63 52 60
60 57 60 57 60 60 57 57 52 52 57 60 60 57 60 48 35
48 52 35 48 60 57 57 57 60 60 43 47 40 34 47 40 40
21 23 40 35 20 27 47 60 57 46 57 63 63 60 52 57 60
53 63 53 60 52 60 58 53 43 58 48 53 53 57 57 63 48
48 58 52 63 60 52 63 40 63 57 63 58 52 57 57 52 42
52 52 60 52 63 57 57 57 57 57 57 57 57 48 48 60 48
48 48 48 60 57 57 48 60 60 52 52 53 53 53 52 60 63
63 63 63 57 57 57 57 57 59 52 43 43 57 57 52 60 52
57 57 52 52 37 57 52 46 60 47 30 18 35 35 24 23 23
47 24 18 24 29 29 27 35 57 40 41 42 63 28 60 60 57
53 60 57 42 57 57 52 46 57 60 57 48 43 35 57 60 35
57 48 48 48 35 25 60 52 41 57 48 48 35 60 57 48 20
40 42 42 42 46 43 58 26 43 40 35 60 19 47 47 57 60
42 42 60 42 52 31 22 33 23 8 18 20 20 22 33 28 52
52 32 24 39 46 35 20 20 20 28 33 42 35 47 41 39 35
16 9 7 19 8 9 12 8 10 9 9 30 47 40 35 24 17
13 6 11 12 13 18 13 28 18 12 20 10 22 29 14 11 27
21 10 17 31 11 16 13 10 10 7 10 16 6 6 9 12 17
26 7 9 13 30 35 17 9 6 10 17 18 8 8 8 9 7
9 10 11 19 19 13 28 28 8 11 9 14 18 12 8 11 11
6 13 11 18 16 19 12 9 6 9 22 11 11 9 9 9 16
30 10 11 20 10 18 11 23 9 9 11 6 6 9 11 9 6
11 23 11 11 6 7 11 9 11 9 6 6 9 11 9 11 18
13 16 11 9 6 13 6 8 13 6 9 11 16 9 8 18 9
6 9 11 9 9 10 10 9 11 9 9 17 19 20 27 21 9
9 11 12 10 7 12 6 12 11 10 9 9 14 11 11 13 11
6 13 10 6 9 6 9 10 15 18 18 11 9 7 9 10 10
9 11 9 9 10 6 12 10 9 9 8 11 9 13 16 14 13
11 11 15 21 15 13 10 23 10 14 6 10 11 13 8 11 6
11 10 16 10 9 9 19 19 12 9 11 9 9 14 11 12 9
11 9 6 9 10 9 9 11 13 9 11 11 16 11 9 11 9
6 11 9 9 11 14 8 9 8 5 7 8 5 7 12 10 11
18 16 12 14 5 14 8 14 6 8 12 6 11 11 10 14 14
9 9 22 14 8 6 13 10 9 12 8 7 11 14 8 9 6
6 18 8 8 9 10 10 10 9 10 11 11 6 7 10 12 7
9 11 11 12 11 10 12 10 8 11 14 11 14 14 19 11 10
9 10 8 10 8 6 10 5 14 12 8 7 5 5 8 5 10
9 8 9 6 5 14 9 14 14 5 14 5 6 10 6 8 14
6 8 12 10 5 6 12 14 5