S03036-01_A08
Seqid S03036-01_A08
Sequence >S03036-01_A08.phd
NNNNNNNNNNNNNNNANNNNNNNNNNNGGGCGATTGGCGGCCAAATCGGCCGAATTGAGA
AACTATAGTTTCTTAAGAACTACCTGATTAGAGGTTTGCTACTGTATGTTTTCCTTGTCT
AAAATATTACTGAAACAACTCTGAAACAATACTAAAACATTACTCATATCATGCTATTGG
GTTACCACATTCAACAAAAAAGGAACGACCCATTTTTGTGGAAAGACAAAGTGCTGCGAA
GTCATACATTTCCAATTTCATTATTGTTTATTGAACATACTCTGTTGGCTTTATTACCGT
CCACGCTTTTTCTACAATAGTGTAAAATTTCTTTCTATGTTTATCGTATTCTTAAAATGC
TTCACGAACACCGTCATTGATCAAATAAGTCTATAATATTAATATACATTTATATAATCT
ACGGTATTTATATCATCAAAAAAAAGTAGTTTTTTATTTATTTTNNNAAAAAACNAANGN
CNNGGAGGANGGGGAGAAAAGGGAAGAAANTTATTTTATTTTCTGNCCAAAAGGGCCAAC
TTGAAAATNCAATNGGGTCGNNNAATAACTTGGCGGAATAAGGGACAAACTGTTANCNTC
NCCAACTTGTAANCCCCGAANGGTACCACAGAAAGNNCAATTTTTAAAAATTGTNAAAAN
ANTGAANGGACAANGGGTGAGGGNNAGGAATTGTTTGAAAAGGTTAANNTGAAANNNCAA
TTTNNNGAACCTGTCAGCNAGGCNNAAAAATNNGTAAGANCANGNNNNTTTNATNATAAA
CATNCAAGAANAAAAGCGGACANCNTNGGNATAAGGTGTGANNTAGTGAGAAGAGGGTAC
NACCNCTCGCCNAAGGGNGNTGAACAGANATAAAGAGNNANNANN
Quality >S03036-01_A08.phd
4 2 2 3 4 3 5 4 5 3 4 7 2 5 5 9 7
6 5 7 3 3 3 3 3 3 3 9 17 24 9 22 31 15
27 31 18 17 27 21 14 24 9 12 16 41 35 35 28 40 41
41 32 13 28 41 34 31 31 24 30 28 21 30 37 50 46 49
49 49 46 49 46 28 46 44 32 37 33 32 50 50 49 46 43
46 35 28 31 42 49 54 49 42 42 35 35 30 34 42 42 39
46 49 34 42 35 46 39 42 42 43 54 46 50 54 54 43 49
44 42 50 43 49 54 54 53 44 49 50 43 43 47 60 49 50
50 54 54 57 50 50 54 52 54 50 54 52 60 60 60 50 50
50 54 49 51 49 58 63 63 58 58 58 57 50 57 54 58 57
50 58 63 57 52 57 52 63 63 58 63 57 52 57 52 58 52
63 57 63 58 52 52 63 52 57 63 63 63 63 63 52 63 63
57 52 57 52 52 60 52 52 57 60 58 60 63 63 57 58 57
52 58 63 60 52 47 57 52 57 60 60 57 42 48 57 47 42
35 43 35 48 48 60 58 57 57 60 58 63 63 57 52 41 63
57 63 53 52 42 52 63 57 52 63 53 52 63 52 57 52 63
63 57 63 57 60 60 60 48 60 57 60 63 47 60 63 52 47
60 63 52 60 52 63 57 52 63 60 57 57 48 60 57 57 60
58 63 63 41 43 43 44 44 52 29 46 57 57 60 60 57 35
47 43 41 41 35 43 29 42 57 46 43 60 52 57 52 52 39
43 40 40 41 40 35 39 44 40 47 43 34 42 40 40 34 43
40 42 42 57 43 41 57 52 60 57 46 57 60 57 60 57 57
52 60 52 63 57 52 52 52 60 52 52 60 52 46 52 60 47
57 57 60 47 58 52 57 52 52 44 43 57 60 44 43 47 52
52 60 52 57 57 60 60 52 60 52 57 52 60 52 44 60 35
43 42 57 57 57 43 32 35 33 31 60 52 23 44 46 40 46
21 9 35 52 36 21 35 47 57 60 60 47 44 52 44 40 20
14 17 20 23 8 5 6 5 14 14 16 16 9 11 9 6 9
9 7 9 7 9 6 6 10 14 16 9 12 9 7 9 13 8
16 12 9 14 16 14 10 11 9 11 12 9 8 10 11 10 6
14 12 9 11 10 10 10 9 11 24 22 22 10 9 9 7 13
16 8 9 9 23 15 33 28 35 24 19 12 16 28 15 13 11
9 8 13 9 7 12 9 14 9 7 8 12 21 16 10 8 7
6 7 9 9 12 13 14 9 11 10 21 26 18 9 9 18 10
9 8 17 9 21 29 19 12 22 35 34 12 10 12 16 11 9
6 9 6 9 9 6 11 10 18 14 11 21 16 12 11 11 10
7 12 17 10 14 8 10 11 6 9 9 9 10 14 13 12 24
9 16 13 13 10 9 6 6 8 11 18 9 18 16 13 11 12
11 12 12 9 8 8 9 9 6 8 19 16 14 7 9 6 12
12 9 9 7 12 10 8 10 10 19 7 10 9 14 9 12 19
13 8 11 6 7 9 8 11 11 11 11 10 11 9 13 9 14
9 9 8 10 11 11 9 13 12 18 6 6 10 9 10 9 12
6 7 6 10 10 11 9 9 10 6 7 6 9 11 33 20 26
9 13 14 11 13 10 11 6 9 20 17 9 6 6 9 8 9
16 11 9 7 6 9 18 13 13 12 8 6 11 9 7 11 6
6 6 6 13 11 9 6 9 9 7 9 10 10 8 12 10 8
9 6 9 9 13 13 10 9 6 16 9 13 8 10 12 10 9
10 10 11 6 9 6 16 5 9 11 6 8 13 16 9 9 11
11 12 8 9 11 7 7 9 11 9 10 8 25 8 14 23 9
19 9 9 11 11 8 11 6 8 8 10 6 14 11 8 10 9
10 6 9 19 8 10 10 5 9 6 8 8 9 9 9 11 11
16 6 9 11 9 14 14 19 13 10 6 5 10 5 5 9 6
5