S03036-01_C23
Seqid S03036-01_C23
Sequence >S03036-01_C23.phd
NNNNNNNNNNNNNNNNNNNACNNCNNNNANNNNGGCGATTGCGCGGCCANNTCGGCCGAA
TTGACAAAGAAGTCACAAGATTACTTGGTAAGAAAGAAGCAGTTAATTTTTAATTTTGCC
GACAAGCCAAGATGCAAATTTTCGTCAAGACTTTAACCGGTAAGACTATTACCCTGGAAG
TTGAATCTTCTGACACTATTGACAATGTCAAGTCCAAGATCCAAGACAAGGAAGGTATTC
CACCTGACCAACAAAGATTGATCTTTGCTGGTAAGCAATTGGAAGATGGTAGAACTTTGT
CCGACTACAACATCCAAAAGGAATCTACTCTACACTTGGTCTTGAGATTGAGAGGTGGTG
GTAAGAAGAGAAAGAAGAAGGTCTACACCACCCCAAAGAAGATCAAGCACAAGCACAAGA
AGGTCAAGTTGGCTGTCTTGTCCTACTACAAGGTCGATGCTGAAGGTAAGGTTACCAAAT
TGAGAAGAGAATGTAGCAACCCAACTTGTGGTGCTGGTGTTTTCTTGGCTAACCACAAGG
ACAGATTGTACTGTGGTAAGTGTCATTCCGTCTACAAGGTTTAACGCTTTAAGTAAAGTA
TTCTTANACCTTATATGTTTTTGAGTGAGCGGTAAAGTTGTGAAAATTCTTTTTTATTTG
AGAAAGCGAGANGGGAAACGAGGAACCGGAGGGAAGGGGTGCGGGGCATAGGGGCAGCGT
GNGAATTCTCTAATGCCCTCCAAATGGGGGCGGGGGGGGGGGGGGAGGGGGGGTATCCTG
TGGTNAATTTTATTNAAANAGNATTTTCCCACCGCCCATGCCGCTCGGAGCGGGCAGGGG
GGATNGGGGGGGGGGGAATCGGGGGGCCCCGTCCCCCGCTGGGGGGGGGGGGGGGGGGGT
GAANAN
Quality >S03036-01_C23.phd
6 3 3 3 2 3 6 4 4 3 2 6 6 6 7 7 5
5 4 8 8 7 5 10 7 5 7 5 10 3 5 3 3 8
14 8 21 17 17 20 24 8 16 12 32 24 11 12 9 7 5
29 27 21 19 23 17 12 16 12 26 27 17 9 13 11 15 23
24 25 31 31 40 35 28 36 36 31 50 27 16 25 39 34 49
37 34 47 40 32 31 35 38 38 35 34 43 41 32 46 33 32
40 38 37 49 44 49 49 40 29 43 29 40 46 35 41 42 31
32 37 42 40 31 49 49 54 50 46 46 30 23 41 40 40 35
37 42 42 43 53 49 51 54 49 50 30 49 50 42 44 51 53
50 54 50 50 53 53 53 50 49 51 42 39 34 50 51 53 51
57 57 51 51 50 45 43 42 49 50 57 53 54 53 53 51 57
57 57 57 57 53 45 54 42 51 51 50 53 53 53 45 49 42
53 53 53 53 50 49 51 58 58 49 50 54 49 49 63 54 51
45 47 49 50 57 59 54 60 58 51 45 46 44 63 49 50 45
49 49 52 60 52 43 35 44 33 19 21 32 60 57 57 58 63
63 52 52 60 57 52 52 60 63 63 57 60 57 57 63 63 57
57 60 60 58 60 63 57 63 63 63 63 63 60 52 28 63 63
57 63 57 63 57 52 60 63 63 60 57 60 63 57 58 44 52
57 58 44 60 58 52 60 60 52 47 63 63 63 52 63 58 57
52 60 63 60 58 63 60 58 60 63 57 57 63 63 63 58 57
57 60 60 58 52 52 52 52 46 60 57 57 52 52 52 42 57
52 46 43 43 42 60 57 60 57 46 60 57 57 57 60 60 54
50 63 60 63 43 42 58 49 52 49 44 43 40 47 44 42 35
38 21 20 31 43 49 47 50 60 44 45 42 54 60 49 49 54
54 54 54 49 60 60 47 49 42 63 50 58 49 47 63 42 49
47 51 60 60 60 50 47 47 49 49 60 60 49 60 50 49 42
60 46 47 50 50 54 54 42 60 44 51 42 60 60 50 42 46
47 60 60 58 43 42 60 47 40 60 47 42 21 19 19 33 33
27 60 60 60 38 38 35 35 42 38 27 44 35 60 44 31 42
35 28 35 60 47 60 49 60 50 54 54 60 63 49 49 42 49
49 49 49 44 54 42 42 44 36 54 50 49 49 35 36 44 27
38 43 42 38 44 27 42 35 27 11 28 25 42 42 35 39 39
44 21 28 32 19 31 31 39 47 16 49 44 22 38 31 44 38
44 27 22 22 31 34 28 35 23 38 35 44 19 33 9 47 28
38 16 21 11 33 35 16 23 33 33 28 19 31 32 16 21 32
28 28 13 14 22 24 13 11 12 11 10 7 8 11 12 14 24
23 20 11 11 11 12 15 21 15 17 18 16 19 12 34 10 10
11 24 22 12 16 11 14 12 11 16 11 16 10 10 15 15 13
11 9 9 10 15 38 47 34 19 13 19 8 25 13 12 9 9
16 14 11 9 10 11 13 10 6 10 12 15 14 15 11 11 11
12 10 20 13 11 10 13 25 18 17 19 13 10 9 16 14 11
31 32 16 16 16 26 17 23 10 10 8 10 8 11 35 46 11
11 12 19 12 16 11 9 7 10 9 15 24 27 20 19 13 14
14 18 13 20 11 10 19 12 26 15 11 18 14 11 15 9 10
11 14 11 8 13 10 9 12 9 13 13 11 30 25 19 11 11
13 10 14 16 18 22 19 19 14 14 11 11 12 9 11 11 11
14 10 7 14 16 32 22 22 14 18 17 15 6 9 14 12 6
11 28 6 14 14 28 16 13 14 18 14 15 11 12 14 15 20
12 16 10 13 9 13 10 9 9 11 13 25 18 19 9 13 28
26 11 10 23 21 13 34 24 13 10 11 6 12 14 16 14 14
23 14 15 26 9 18 14 28 11 9 18 9 10 17 8 15 17
10 9 13 13 9 11 14 18 13 11 9 11 16 24 17 11 12
11 16 36 17 17 10 15 21 17 15 8 23 16 19 19 16 11
8 10 6 10 6