S03036-01_D01
Seqid S03036-01_D01
Sequence >S03036-01_D01.phd
NNNNNNNNNNNNCCNNNCCCNNNANNNANGGCGATTGGCGGCCAATCGGCCGAATTTGGA
AGACAGACGAAAACACATTTAAGGGCTATACAAAGATGAATATGGGAGGCAGTAGCAGCA
CTGCTGCCAAAAAAAGCGACTTGTAAAATATCGATGTTATGGAATTGGTATACCATTGAC
ACCTGCTTCATTGCCAGATCTTGGAGAAATGACACCAAAGGAAAATTTGCTGGTTCTTGC
ATCGGTTGTTTTGCGCTTGTGGTGATAGCTCAATGGCTTACTCGTTTTTCAAGGCAATTT
GACGTAGAGCTATTAAAAAGACAGAAAATAAAGCATTTAGCTAGTTACTCGCCAGAGGAG
TATGTTGTCAAATGTGGAGATGAGGATGCTAAATCTGATATAGAAGAACTACAAGGCTTT
TACAACGAACCAAGCTGGAAAACAACTTTAATTTCCTTACNAAAAAGTTTCATTTATAGT
TTTTACGTTTGGGGTCCAAGGAGATTGAACGAGCCAGAAGACGACCTGTTAAAGAAGGTC
CTATCATGCTGTACNTTAATAACACCAGTGGATTNNTACCCAACNTTCTTGGATCNCCTG
ANAAANGTGACGGTTTTCGTAGTAAAGTGGGGGNTTCTNGTATCTANNAAGTGCNATTCA
AGTACTGGGNCGGGGAAATCCCTTTANTTGTTTTNTNGAGNAAAAAATAAACCAAGNCGA
GTTTCCCTACAACNTGTTGNNTCNNTGGNGGNAGNTGGAGTAGCCTTGCGCTNGCATNAA
TATGATGNAGGGCGGANGNNAGCNCNGTAGGGGNTGTATACGAGATTGCNAAGAAGANCN
NGNTCCNACANAACTCNCNCTTGCNGCGTTCNCCANNCAANAATGTGAATG
Quality >S03036-01_D01.phd
2 2 5 3 3 3 3 3 4 6 3 4 9 10 5 6 7
10 10 8 7 5 7 8 5 6 7 8 5 12 26 10 25 23
15 29 30 19 13 26 27 14 14 25 26 41 36 41 24 36 41
32 25 15 27 47 35 31 29 17 14 26 26 14 19 35 32 22
36 43 41 49 41 29 31 37 50 43 51 42 46 43 28 40 23
31 46 38 42 49 49 32 38 36 35 30 29 36 42 46 52 52
42 52 53 47 42 43 43 30 46 46 43 50 43 46 46 43 54
35 30 39 47 51 52 54 49 50 30 49 49 49 49 49 49 43
42 54 42 42 49 49 40 42 35 49 49 57 35 42 43 51 46
42 46 49 54 49 37 50 57 57 42 53 34 57 50 53 35 42
43 33 42 51 35 50 53 35 39 37 27 50 57 50 54 50 54
57 38 30 43 53 46 42 49 27 43 57 24 42 43 51 49 45
39 19 34 53 51 30 59 44 30 19 42 57 17 57 53 34 57
44 57 57 53 33 53 53 39 25 40 49 53 20 46 39 22 34
35 22 22 46 39 28 53 27 51 44 17 57 53 53 30 21 36
42 31 53 39 22 39 53 26 43 29 20 27 24 35 33 30 19
42 28 32 22 17 31 53 27 20 33 28 21 27 53 53 53 53
27 12 42 32 57 12 21 51 23 53 42 23 25 27 24 30 20
13 45 17 26 28 18 26 42 18 57 57 53 53 14 39 15 19
20 38 57 53 53 16 23 57 57 21 30 27 31 51 43 21 28
36 25 18 35 18 42 18 32 19 35 18 25 49 19 27 39 8
51 30 16 29 31 21 42 19 44 42 18 31 12 53 51 35 40
24 35 53 41 28 31 25 46 50 14 51 27 17 31 31 31 24
53 53 35 35 35 49 41 24 35 32 27 27 54 57 18 40 39
32 35 26 35 13 49 19 53 17 29 34 37 43 25 31 10 51
35 26 37 51 17 43 15 39 27 35 35 35 43 19 30 47 57
27 25 51 28 26 51 45 27 43 15 47 53 27 53 26 49 26
29 6 34 35 21 20 24 22 31 26 34 27 17 31 34 34 18
35 31 28 18 20 19 30 35 25 20 23 25 31 35 16 23 21
30 18 22 20 9 31 15 37 26 15 29 9 35 21 10 26 28
21 37 20 27 35 26 19 49 42 17 39 12 27 49 17 23 27
35 24 21 9 23 23 15 29 28 17 23 10 25 32 19 24 15
20 18 17 17 13 26 42 19 19 17 7 17 27 12 33 23 14
39 43 13 17 36 27 21 18 33 14 26 17 16 7 5 8 17
11 12 27 18 24 22 7 12 13 10 35 35 28 35 30 16 20
6 16 8 19 32 24 6 11 9 8 7 18 9 9 9 20 9
8 13 19 16 11 14 20 10 12 10 13 23 11 19 31 14 41
45 14 11 9 7 10 10 13 9 6 9 11 9 10 9 9 9
6 6 9 10 10 11 24 13 7 11 11 14 12 10 9 24 10
13 11 10 11 9 11 6 11 26 23 10 15 9 10 11 11 14
11 11 9 11 13 8 6 10 12 19 13 9 8 9 7 11 7
9 9 14 7 13 12 13 16 11 14 11 15 10 10 10 9 14
10 8 6 11 10 19 9 20 11 13 11 34 11 9 9 9 14
12 12 6 9 9 9 10 8 6 6 9 11 7 6 11 9 10
6 9 8 6 10 9 7 14 11 9 10 9 11 10 10 11 9
12 10 9 8 11 9 11 7 8 11 14 10 7 10 9 10 9
10 10 14 11 14 6 12 18 10 9 11 11 11 10 6 14 7
6 9 13 9 7 9 6 10 12 11 12 9 8 11 6 9 11
10 10 9 11 11 9 10 9 11 9 9 9 10 6 10 10 9
11 12 11 11 6 9 6 5 8 6 9 12 11 7 8 11 9
6 8 9 14 10 9 6 9 6 9 9 9 11 9 6 9 14
14 8 9 8 6 11 8 9 6 6 9 9 9 6 10 9 14
9 9 9 9 9 9 9