S03036-01_D05
Seqid S03036-01_D05
Sequence >S03036-01_D05.phd
NNNNNNNNNNNTNNNNGNNNNNNNNNNATAGGNNGATTGNGCGGCCNAATCGGCCGAATT
GACAGCAGACACAAAGAAAAATGGCAAACCCAACAACAGGGAAGTCCTCGATTAGGGCTA
AGCTTTCTAACTCATCGCTATCAAACCTATTTAAAAAAAATAAAAATAAAAGACAGCGTG
AGGAAACGGAAGAGCAGGACAATGAGGATAAGGATGAGAGTAAGAACCAGGATGAAAATA
AGGACACACAGCTCACTCCCCACAAGCGTCGCCGGTTGACGAAGGAGTTTGAAGAGAAGG
AGGCTCGTTACACCAACGAGTTGCCCAAGGAACTGCGCAAGTATCGTCCTAAAGGTTTCA
GATTCAATTTGCCTCCAACGGATAGACCCATCAGGATATATGCAGATGGTGTTTTTGATC
TTTTCCATCTTGGCCACATGAAGCNNCTGGAANNGTGTAAGANGGGTTTCCCNNNTGTCA
GCTNATAGTTGGGAAGGGAGGGGACGAAANCANTGANTAACGAGATNGNTTGAATGGACT
GGAAGAAGGAGCAGCNTTGGGTANTGNNGCTACTGTGAAGGGGGGAGAGAAATACGGCTT
CTTAACCCCGGTATGAGAGACGGTAGGANGGGAAGAGGAAAATATGGANNAGATAGTTAA
ATGANTAAGAGATNGAAAAAAGGCGNGGATAAGTNACTTGAAGGGGAAAATAGGGATTAA
NACGCTCACCTNANNNGNGTAGACAAGNGGGCTANNGANGAGGGGNGGGNTGAGGTNGAG
CNNGTANGTNTTTAGTGTGCAGGTAAGTAANTNAANNTGAGGGGATAANACCGTATGCGA
GGTGATGTGNCCCGGGAGCGCGNGACCAAGGNGAGAGGTCGTTTGNNNNAATTTGNAGN
Quality >S03036-01_D05.phd
2 3 3 2 3 2 2 3 3 3 6 11 6 4 5 5 8
6 5 5 5 7 7 5 3 5 6 12 9 16 9 10 5 5
18 22 18 29 27 7 16 15 25 24 16 24 6 13 22 43 36
37 21 41 35 23 25 21 27 30 21 13 21 12 20 30 30 32
24 20 29 40 26 28 32 36 42 49 49 49 28 28 36 25 34
43 46 46 40 40 38 30 36 42 30 40 42 16 31 34 23 22
32 29 42 42 49 40 42 30 34 38 31 30 39 53 30 23 28
28 33 33 32 32 35 42 39 33 39 42 47 49 49 50 60 47
42 42 39 42 44 47 42 42 60 50 57 42 52 57 57 45 35
60 60 60 60 63 60 43 60 52 63 47 43 43 60 57 57 57
57 60 52 52 47 48 48 48 52 52 52 52 57 52 60 52 52
52 57 52 52 35 52 47 57 46 42 60 48 52 48 53 53 53
48 48 63 52 52 48 48 48 53 48 48 48 53 48 53 57 52
60 52 60 52 57 52 57 39 52 57 48 47 57 52 48 48 52
60 53 53 52 48 32 35 39 45 35 47 44 48 47 48 53 60
45 52 57 60 57 60 57 57 46 57 57 60 57 60 53 57 52
57 52 53 43 53 48 52 37 57 58 60 16 53 48 31 60 53
53 53 48 41 44 60 53 57 53 27 63 45 32 53 30 48 44
48 48 53 29 44 26 39 48 29 52 48 45 48 47 48 43 45
39 57 57 42 52 32 53 48 53 46 60 60 57 45 45 35 41
35 52 41 42 47 45 42 60 48 45 53 48 43 35 48 23 48
43 35 28 57 52 20 60 45 19 28 47 60 48 41 25 48 43
45 44 18 35 44 34 18 22 32 42 60 52 45 35 35 35 48
39 57 32 53 48 45 35 48 47 52 48 44 47 45 52 42 57
60 45 52 42 45 44 44 47 53 46 37 47 36 42 47 42 39
35 28 53 53 35 27 12 12 11 19 13 18 23 53 28 33 37
37 13 7 7 16 35 15 12 13 14 5 7 21 34 39 45 23
22 21 13 5 10 18 9 13 17 19 21 34 9 6 7 6 11
18 11 11 11 8 18 11 6 9 23 14 18 14 11 11 13 8
9 9 8 9 9 9 11 23 14 23 14 16 9 16 12 11 7
11 11 6 14 9 11 6 9 9 9 10 8 9 9 11 10 6
8 7 12 37 16 25 12 16 22 10 18 13 11 9 9 9 9
11 9 19 12 9 9 11 27 37 11 15 6 9 11 19 12 8
9 11 6 11 9 7 7 9 10 13 10 11 9 10 13 12 14
23 10 12 23 14 10 8 11 10 11 8 15 15 11 9 9 11
14 10 10 8 11 9 8 11 16 16 16 10 9 9 14 11 16
11 11 17 11 11 14 14 10 10 13 13 10 10 9 11 12 6
11 13 11 18 10 10 11 9 12 20 24 24 27 18 16 8 8
11 9 6 6 19 13 20 16 14 10 13 11 8 11 9 9 11
11 7 11 14 12 14 13 14 10 9 6 10 10 9 9 11 10
11 10 11 10 14 7 12 19 13 11 11 9 10 9 6 11 9
11 9 11 9 10 10 11 9 10 11 8 9 11 9 14 9 9
8 10 9 10 9 10 6 9 11 9 11 9 10 9 9 11 10
6 8 6 6 7 14 6 9 9 11 9 11 10 9 10 14 6
14 14 9 9 11 11 6 6 10 10 7 8 9 11 9 9 10
6 9 14 10 7 8 10 11 11 11 9 6 10 9 10 11 6
6 10 11 9 6 9 11 6 9 10 9 9 10 8 10 9 11
10 9 10 14 10 10 14 10 9 8 9 6 9 6 8 10 7
6 8 18 11 9 11 10 10 11 8 9 9 7 14 10 11 11
9 11 9 9 9 9 15 10 11 10 9 14 8 9 9 8 6
9 10 10 8 9 9 9 8 8 11 9 9 6 11 8 9 8
9 9 10 8 7 14 9 14 9 8 11 10 8 8 9 10 9
8 7 6 6 6 9 14 10 11 11 8 7 9 8 6