S03036-01_D08
Seqid S03036-01_D08
Sequence >S03036-01_D08.phd
NNNNNTNNNTTNNNTNGCCNCNAAANNNNNGGCGATTGACGGCNTATCGGCCTTTTTGGT
GGGTCAACAAATCAATTTGTACAAAACAAGTACGCATAAACTTTGAGAGCATGAGTGTGA
CCAATGGTGGCGATGCAGCCAGGGAAAATTCTGAGGTGAAGCAAACTGCAGTTGAAAATC
CTATCGATAAACTAGATGGAACTCCTAAGAGACCGAGGGAAAAAGATCAGGATGAACAAG
CGGAAGAAACGAGTGACAAATCAGAAGCACCCAATAAAAACGATGAGGAGAAAAAGGAGG
AAGGTAAAAAAGACCAAGAACCATCACATAAGAGGATCAAGGTTGACGACGGAAAGACCG
TAGAATCTGGTAGTGTGGAAGATGACAAATAGGANGATNANTTNGAGTTCNGCNCCGNCT
CTNAANTTTATGNGTGGGATAANGGGTACAAANAATGAATCTTCCACNTTCAACANNNGA
CNGAGAAGAAGNGGNTGGCNNNTTATTTTTTTTNTCTATTTTAGATNAAAGAGGTGGTTT
NAGNATGTCGATNTAGGTNNNTTATATAAAAAAGAGAAANNAAAGAANAAAAAAATTAAC
CNCCATTGNGGGGGAAGGGAGGTGGAGATGGTGTAAATANTTAATTTTACCACAANTAGC
AGGGTGGGGNGGGTTGGGAATAGCAGTNTTAAGAGCGTTTGTGGNAGATGTNCACAAACC
AATCTNCCANACCACNCCAAGGAGGGNGGNNAGGAGGGGAAGGGNGGGGTNTTTGAANTT
TTTCTTTAGTTAAAGAATAAANAAAAAATAAGAAATACCAAAAAAATAGTAATTAGATAA
GCGTGTTATNGGGAAGANAGGGGGAAAGGAGTTGAAAGTATCGCTNNCTACACGGGAGAG
GGGGAAGNTGAAGATGGGGTTGAGGNTAGGTGTTTTGTNTNTNNGTNNATTTATNTTTTT
GAAGNGNGATCCTAAAN
Quality >S03036-01_D08.phd
7 5 7 6 5 9 7 5 7 13 8 5 7 6 12 7 12
9 12 6 9 6 9 10 8 7 7 7 5 5 15 9 9 9
9 9 9 11 11 9 9 17 9 6 9 9 28 16 15 12 22
17 10 10 17 35 22 15 11 15 41 28 33 19 28 10 11 15
10 12 23 18 13 12 13 33 46 32 27 19 18 42 13 13 14
32 29 14 19 24 33 14 45 14 35 14 24 10 22 11 40 32
23 19 23 18 23 27 38 18 23 31 40 53 40 53 53 53 46
35 37 35 24 40 42 53 33 40 44 37 33 19 35 35 41 53
18 14 40 37 34 40 53 37 48 60 57 53 53 60 57 53 46
53 53 46 53 52 52 57 53 60 53 53 60 53 53 53 53 53
37 53 53 52 52 53 53 53 53 57 60 57 60 60 53 53 53
57 57 53 53 52 52 53 53 53 53 58 58 53 52 53 53 53
53 53 53 53 53 53 46 37 37 53 53 53 53 53 44 53 53
53 60 52 47 52 53 53 53 53 53 37 35 35 46 37 42 38
30 30 46 46 46 43 53 37 52 50 37 37 40 46 37 46 46
37 42 27 40 42 53 57 60 53 57 53 53 58 52 48 53 46
46 53 46 53 53 53 46 46 53 53 53 53 53 52 52 63 52
53 53 53 52 53 53 53 53 53 35 53 46 46 35 41 46 44
42 42 53 60 53 57 40 37 48 53 57 53 53 53 53 46 46
53 53 60 60 53 53 57 53 35 41 21 44 40 35 37 35 27
38 53 44 44 53 35 37 38 53 53 37 35 30 28 38 31 37
37 35 26 20 14 8 19 37 37 46 53 53 53 53 57 60 53
42 40 40 14 24 23 8 33 33 11 19 11 9 11 18 11 23
23 12 10 6 16 12 11 7 10 6 16 13 6 10 9 39 46
14 8 6 11 11 6 11 35 10 6 11 26 19 11 6 11 9
6 12 17 8 9 10 9 6 10 12 9 11 11 10 14 9 8
6 10 8 9 9 17 11 9 9 9 6 11 9 9 9 9 12
11 11 10 10 9 13 9 10 7 8 8 8 10 11 12 9 6
7 7 10 9 8 6 11 10 13 9 10 18 11 9 9 7 9
11 6 11 11 15 10 6 6 6 10 19 11 9 9 13 11 11
14 11 12 7 14 11 12 14 14 11 11 9 9 10 9 9 7
16 28 15 13 18 20 16 16 18 9 9 9 9 6 12 9 6
15 17 16 28 9 10 9 9 7 10 10 15 13 11 6 6 6
8 9 17 11 14 19 16 11 39 27 28 12 9 10 9 17 12
9 7 6 12 9 16 11 18 12 7 14 17 10 14 14 10 9
9 11 21 9 12 14 6 12 10 9 9 16 16 7 12 13 13
16 16 12 10 9 9 9 12 9 11 10 11 14 11 10 9 9
11 14 14 13 9 11 19 11 23 11 6 9 19 18 11 11 13
11 12 16 14 11 14 14 11 12 6 12 21 16 11 10 11 11
11 11 14 11 14 10 6 9 11 10 14 9 19 11 18 13 14
18 11 16 14 19 11 8 6 11 10 11 19 15 26 10 12 16
14 11 10 14 10 10 16 6 10 19 11 10 10 9 6 8 14
9 13 18 19 9 11 27 27 8 8 8 6 9 9 9 6 13
17 8 11 10 6 12 18 19 17 13 11 8 9 9 10 6 12
23 6 6 12 11 9 10 9 9 10 14 12 9 9 10 9 7
14 11 10 15 13 7 14 18 8 10 11 10 6 11 9 11 15
15 14 11 18 12 10 9 16 17 14 14 14 11 29 12 11 14
12 11 6 28 19 21 18 9 9 9 9 23 9 11 11 9 11
11 10 14 14 9 14 17 20 24 21 9 12 13 19 20 12 10
9 18 11 9 11 13 9 8 9 12 10 11 10 12 10 9 6
10 9 14 18 12 11 11 6 9 11 10 12 11 10 12 9 9
9 9 8 8 10 9 11 9 10 16 10 14 16 8 12 9 9
9 7 6 9 8 10 13 9 14 11 9 10 14 12 9 10 13
9 14 24 19 16 9 6 9 16 9 22 9 11 8 9 11 10
11 10 11 11 11 14 9 6 9 19 14 11 14 19 10 11 11
11 8 10 6 14 6 11 6 6 8 10 6 6 9 11 16 9
9 14 6 9 9 9 17 16 12 13 9 9 6 10 6 9 8
8 11 8 10 11 10 9 6