S03036-01_D13
Seqid S03036-01_D13
Sequence >S03036-01_D13.phd
GNNNNNNNNNNNNTNNNNGGNNNNNNNTNNGGGCGATTGGCGGCCAAATCGGCCGAATTA
CATTTTTTTTTTTTTTTAAAAAAAAAAAAAAGTACCGGCCATAAGGGCCAGCTTGAGTAT
TCTATAGTGTCACCTAAATAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAA
TTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTG
GGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCA
GTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGG
TTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCG
GCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGG
GGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAA
GGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCG
ACGCTCNAGTCAGAGGTGGGGAAACCGGAAGGGANTATAAAGATTCCAGGCGTTTACCCC
TGGAAAGCTTCCCTCGGGCGCTCTCCTGTTCCGNNNAGAGAGACGGGGGAACTATTTATA
AGATGAGGGGTGGANGAAAATAAAGATAGGAGATAAGAGATTTTTCAGGGCAAGGCGTGT
ACCAAGGACCCCCGATAGAGATTTAAAAGAGAGACCTATCCTGTACAATTCAATTTTATT
CAATTNATAAGGNGGAGTGGTAAGTTGNTTGAATGAGANNAATAAGCTTTANA
Quality >S03036-01_D13.phd
8 3 3 2 2 2 3 4 4 4 2 3 6 13 5 4 3
3 15 9 3 3 5 3 6 3 5 8 5 7 10 15 23 12
25 31 16 41 29 17 18 46 24 16 27 10 15 30 47 43 47
26 42 48 48 32 27 37 41 22 39 20 46 52 50 50 49 50
52 51 51 51 49 49 49 49 16 25 51 51 49 49 49 49 52
52 49 40 40 33 31 29 37 46 42 49 49 43 49 42 35 49
42 54 49 54 42 49 50 42 54 54 54 59 50 39 43 42 44
41 57 57 50 57 59 57 50 49 51 54 54 42 42 49 43 54
57 57 54 50 54 54 54 57 57 52 54 59 54 59 59 54 50
49 54 57 51 50 57 54 50 51 49 49 50 57 57 57 51 57
54 50 57 50 51 54 52 51 51 51 50 57 57 57 50 49 51
57 49 41 44 44 49 47 60 47 51 51 58 58 54 47 60 49
46 49 60 58 49 58 54 60 54 58 49 60 58 47 60 43 33
44 60 50 60 54 60 60 63 54 51 60 60 43 46 50 47 41
21 43 63 63 63 60 57 47 43 44 54 60 60 58 54 54 60
63 57 60 57 50 54 60 50 52 50 44 60 50 63 58 54 63
54 63 51 47 47 49 63 49 50 50 47 51 49 60 50 49 63
47 63 43 47 49 57 63 50 44 54 31 47 49 60 54 60 46
49 57 50 32 43 46 49 49 49 49 46 50 27 53 36 43 51
49 50 50 39 46 43 43 54 42 49 50 59 34 54 43 44 36
50 35 54 42 39 54 39 54 43 46 46 27 22 28 31 31 52
31 50 50 28 57 57 50 31 50 42 34 35 51 54 57 51 36
42 43 54 39 50 49 37 49 31 29 49 49 35 42 49 39 42
49 49 35 42 42 34 41 49 42 46 43 42 50 49 49 42 43
59 54 42 42 49 42 42 42 44 57 42 50 42 27 50 50 39
21 43 35 50 50 30 39 42 54 37 54 30 39 42 42 54 54
35 42 44 59 50 31 54 54 38 59 28 46 49 21 32 43 32
32 54 30 42 18 35 35 28 32 46 16 43 25 29 46 54 41
35 33 28 39 42 59 26 12 30 59 34 40 33 38 32 47 38
54 49 19 38 59 30 35 32 38 37 35 54 32 41 27 36 54
49 21 42 16 37 32 32 38 35 54 59 54 17 43 31 44 29
16 29 21 30 28 24 25 32 38 46 59 52 42 25 54 22 33
23 21 16 24 54 44 44 33 29 43 34 34 42 54 54 54 23
20 24 22 44 46 30 42 12 38 30 44 23 23 44 42 42 38
34 27 30 30 13 9 16 11 18 23 29 30 21 23 34 43 43
43 42 21 21 9 27 31 12 17 11 10 7 16 25 31 19 22
15 44 17 35 19 33 24 14 9 16 14 15 17 22 11 10 11
16 14 12 23 16 7 28 32 33 33 47 32 25 18 11 9 17
23 18 16 13 16 15 35 20 15 10 35 46 33 35 22 20 28
19 46 46 14 33 15 20 32 36 46 33 20 19 14 19 19 29
27 27 33 32 19 14 18 35 22 14 12 12 9 7 7 7 12
22 8 8 9 13 13 9 10 15 32 11 10 11 10 14 19 9
18 10 10 10 11 15 11 9 10 14 9 9 9 14 25 15 12
15 15 16 7 24 9 9 11 11 13 11 16 8 8 16 15 10
12 15 8 10 15 13 14 12 19 13 10 11 13 10 14 11 11
14 10 14 14 14 15 17 10 16 11 12 11 11 13 13 9 8
8 12 15 11 9 11 10 13 11 13 11 14 10 9 11 10 15
16 15 16 16 11 11 19 28 16 15 10 10 12 11 11 15 11
10 12 8 11 9 9 8 9 10 14 11 13 11 15 9 10 11
9 14 17 19 17 17 20 16 17 16 14 9 7 11 12 20 17
9 8 6 9 11 21 11 11 17 12 11 17 14 10 13 13 14
7 9 11 11 9 9 8 11 10 17 10 6 6 18 15 13 12
9 11 10 13 15 14 9 6 9