S03036-01_D14
Seqid S03036-01_D14
Sequence >S03036-01_D14.phd
NNNNTTNNNTTNNNNGGGCNNNNNAAAANNNNGATTGGNGGCGNATCGGCCGANTTGAAC
TGAAAACCCCTAAGCAATCATGTCTAGTCGCCAAGGTGGTAAGATGAAGCCTCTAAAGCA
AAAGAAGAAGCAACAACAGGACTTAGATCCTGAAGACATTGCCTTCAAAGAGAAGCAAAA
GGCCGATGCTGCTGCTAAGAAAGCTTTGATGGCTAATATGAAAAGTGGTAAACCTTTAGT
GGGTGGTGGTATCAAAAAATCTGGTAAGAAATAAAAGGCCTTTAACAACGTCTAATAAAA
ATTTACTCAGTATTTTCTAGTTCTCGTTTTTTAAGTAAATACATATATTACCAAAGAAAA
GCTATTTGCAAGATATNNTATANATTAAAATAAAAAAAAAAAAAAAAAAAANAAATAAAT
AANATNAAAAAAAAAAGGTACCGGCCATAAGGGCCAGCTTGAGTATTCTATAGTGGTCAC
CTTAATAGCTTGGGCGTAATCNGGGTCATANCTGTTTCTCTGTGTGAAAGTGAANNNCCG
GAGAAAAATTCCACTAAAATTTTCGTGCCGGGATGCANAAATGTGTTAAAACATGTGAGT
GGCTTNNTCTGTGACGCCNCCCTCCAACTGAGTGGGGTGGGGGTTAGCTAGANGAAATTT
CAAAATAAAAAAAAACCTTTATACACCACATCGAAAAAGAAGGACAAAAGAGAACCGAGG
TTAGAAANNTAGTTTGATNAAAAGTGTCACATTACTTAATACCCCCCCCACGACCNAAGA
TGGGGATGGTGGGGANAGGTGGATTTCGACAAATTGGGCTCACTTTTATCTGNCCCGGGC
TTAAGCGGAACGAGGATGGGGAAGAACTAGAAAATATTTTTTTAATAAAAATTTTTCAAT
AAAAATTTCCCGGAAGGCGGGAAAAAAGAAGATATAAGATTTTTAGGAAAAAAAAACTAA
AAAAAAAAT
Quality >S03036-01_D14.phd
5 4 6 5 11 11 7 7 5 12 9 7 5 6 6 9 13
12 8 7 7 6 7 7 11 9 11 8 6 6 7 5 14 17
11 15 18 10 6 16 15 9 9 6 10 27 20 31 30 26 22
20 26 7 30 29 16 10 12 22 42 41 35 29 27 24 28 30
34 34 34 35 33 22 29 25 32 39 44 36 44 47 49 42 35
23 34 44 44 27 35 46 33 46 46 59 46 47 46 46 47 52
52 48 46 46 46 39 42 52 60 59 59 52 45 53 53 57 53
53 53 53 60 44 52 53 45 52 45 46 53 46 45 60 46 46
59 46 45 53 36 37 60 53 53 53 48 52 57 59 52 60 52
53 53 48 37 53 52 53 57 57 60 57 53 53 53 53 63 57
52 52 52 60 60 60 60 60 58 60 58 63 52 57 57 63 52
59 57 57 52 52 52 57 52 52 60 60 52 63 60 60 57 52
60 60 57 54 52 45 57 52 53 52 60 57 57 57 52 60 58
60 60 57 52 52 57 52 53 60 57 60 52 60 60 60 53 52
52 52 60 57 52 57 52 52 52 63 53 57 52 57 60 57 57
53 53 57 60 57 57 60 57 52 60 58 57 57 60 48 45 45
48 48 53 48 52 52 52 57 57 57 57 57 48 52 42 57 57
42 47 52 52 57 48 57 47 42 52 46 43 57 57 57 57 52
47 47 47 60 57 52 38 60 60 47 47 50 49 60 60 42 42
42 35 42 47 60 49 49 46 44 26 43 42 59 34 43 42 39
42 42 36 42 42 42 54 54 50 54 44 33 20 44 42 34 42
30 35 37 35 32 50 46 54 54 54 50 43 30 42 38 49 38
59 15 4 6 10 10 8 12 7 12 11 19 27 16 16 13 12
19 33 24 16 32 28 20 15 27 33 23 21 12 16 11 10 18
15 19 15 6 16 13 12 9 9 12 9 12 14 11 7 9 9
7 15 11 13 9 18 19 19 30 18 18 20 26 34 29 34 35
44 44 30 29 16 20 15 28 31 28 19 30 28 17 10 19 30
24 20 19 20 15 14 23 19 20 16 19 25 13 19 12 21 18
12 17 13 30 14 8 8 13 23 16 16 19 20 17 16 15 21
9 13 9 14 28 25 16 13 7 9 17 9 18 25 25 25 15
7 9 25 11 16 19 27 23 11 12 11 30 12 14 10 13 18
17 14 9 10 14 10 9 6 6 7 9 10 16 9 9 11 13
15 16 30 22 24 16 15 22 23 13 12 13 12 16 19 11 11
15 12 12 14 9 9 11 12 10 14 10 16 10 20 11 11 7
14 14 27 16 14 14 10 24 14 41 42 14 16 16 13 11 12
14 12 11 11 16 15 15 13 10 8 6 7 21 10 10 13 14
14 18 11 10 8 10 7 12 17 13 12 10 10 10 11 11 9
19 11 17 11 32 15 16 15 16 16 19 28 12 12 11 9 11
11 13 13 14 14 16 7 12 10 15 12 14 16 19 18 11 14
32 9 14 28 16 24 19 14 26 22 18 20 15 13 11 8 11
9 14 19 11 11 11 10 12 9 11 12 13 8 17 17 14 15
13 8 15 12 15 9 11 10 10 10 18 15 11 10 18 10 13
11 9 9 10 9 11 17 16 11 14 19 10 18 6 7 15 10
10 18 11 12 11 28 10 6 13 11 15 15 13 14 11 11 13
22 14 15 15 14 11 9 11 12 12 14 14 13 12 10 11 16
19 23 17 17 17 16 11 11 15 11 7 13 16 17 11 14 20
18 15 10 10 10 12 14 17 11 11 9 14 9 6 9 16 18
12 16 12 14 8 8 9 12 10 13 9 11 12 12 9 11 10
8 11 9 14 9 9 9 9 11 15 19 20 16 17 22 10 7
18 27 19 25 20 17 16 19 19 14 14 14 17 19 13 16 20
16 14 13 19 15 15 14 20 20 20 13 15 19 11 14 10 13
11 11 16 11 14 14 14 11 20 18 22 16 32 16 17 20 17
11 8 14 22 23 16 13 20 20 23 27 20 16 14 27 19 22
32 17 27 23 23 23 20 22 27 17 17 20 20 16 17 19 23
23 19 23 22 19 22 23 20 16 16 17 18 14 20 11 10 11
14 13 20 22 20 19 27 22 23 16 11 12 11 15 28 15 23
25 19 12 20 17 16 16 19 28 14 28 23 27 23 27 19 15