S03036-01_D15
Seqid S03036-01_D15
Sequence >S03036-01_D15.phd
NNNNNNNNNNNNNTTTNNNNGCAAANANNNNNNNNGATTGGCGGCCAAATCGGCCGAATT
TGGAAGANAAAATACAATTGAAAAGGTTTTACATTTTTAATTTTTCTGCTCATCGCGCTT
TTTTAAAAGGATAAATAAACATTTCTTTAAAAAACATCTTCAATAAGAAAAATCGGTTAA
AAAAACTTTTCTTCTCAAAGCATACCTAATAACAATATAATCCCATAATGCTAGCCCTAG
CTGATAACATTCTACGTATAATAAATTTCCTATTTTTGGTTATTTCCATCGGTTTAATCA
GTTCGTTGTTAAATACCCAACATAGGCACAGCTCCAGAGTAAACTACTGTATGTTTGCTT
GTGCATATGGTATATTCACCGATTCATTGTACGGTGTCTTTGCCAACTTCATTGAACCAT
TGGCATGGCCACTAGTTTTGTTCACACTGGACTTTTTGAACTTTGTGTTCACTTTCACTG
CCGGTACAGTGTTGGCCGTTGGTATCAGAGCTCNCTCATGTAACAACAGCTCATACGTTN
ACAGTAACAAGATTACTCAAGGTTCCGGNNCCAGANGTAGAAANNACAAACCANTCAGCN
CTTCGNGNCTCGCGTGGGGAGGGNGGAAGGTANTGTTATAAACAANNANAANTCAAACAA
AAAAGCAAAAGGTAATNGNTTTCGCGTTATGTNGNAAGANNATAGGGANCCNCACNACCA
CCGAAANCAACACCNAGGAGAAGAGAGAACGGTCNTTTTTTTATATTTAAATAAAANAGA
GNAAAGGGNAAACTTGGNATAAATTTATANATGTNAATCNNNAGANTNNAAAGANNNGAC
GTAACGNAGGGCGNNGNTCNNNANGTGGGGTTTATGNNGNCNNN
Quality >S03036-01_D15.phd
6 5 5 3 3 2 3 3 2 2 3 3 6 12 12 9 6
7 7 7 10 9 10 12 10 7 9 5 3 3 3 3 3 5
5 14 14 15 19 23 10 10 23 29 9 15 11 13 17 31 24
29 26 30 30 28 21 20 34 50 26 18 17 15 15 24 28 5
20 27 32 16 27 29 34 32 44 42 46 37 25 33 40 42 40
35 30 33 27 23 21 33 27 40 40 49 35 27 26 27 31 32
32 35 43 37 32 42 33 33 38 29 37 35 30 25 27 29 37
39 39 43 43 33 33 32 35 42 43 49 44 44 42 39 35 46
43 43 38 46 44 49 46 46 49 50 54 41 46 46 49 57 51
47 49 50 51 51 43 37 45 50 54 50 47 50 49 50 60 60
54 60 54 50 54 50 49 47 49 60 47 60 60 60 49 50 54
63 63 63 50 60 63 63 63 50 42 46 60 50 50 49 60 63
51 63 50 50 51 49 49 50 49 44 60 54 54 54 54 54 54
60 43 42 44 50 54 60 60 60 47 50 47 35 40 43 43 35
47 42 34 40 40 35 33 29 39 43 42 52 57 60 52 60 57
57 63 57 52 35 57 60 60 57 52 52 63 60 60 60 57 60
57 60 60 57 60 63 52 57 57 57 42 60 51 60 51 47 57
60 47 50 60 60 60 47 50 60 52 44 50 47 58 60 50 47
60 54 50 51 42 58 60 49 60 49 49 47 42 63 47 42 60
60 44 63 47 60 60 44 44 60 49 42 57 25 42 43 27 49
60 34 25 32 42 60 47 40 43 33 38 33 42 35 37 43 44
40 36 38 46 39 47 29 29 36 60 60 47 43 27 49 44 50
47 51 47 31 49 58 43 45 42 63 47 42 49 63 47 47 60
49 42 58 47 60 60 47 42 47 46 49 60 46 35 43 42 60
47 47 44 39 46 43 33 43 35 47 24 60 60 38 25 20 39
47 46 38 39 42 42 47 33 47 50 49 43 41 43 33 24 43
35 44 54 47 50 42 35 43 44 40 42 47 43 34 43 33 15
15 33 35 33 39 35 35 47 21 15 14 15 42 42 38 36 30
27 35 29 29 35 60 24 47 27 35 47 35 17 24 33 12 20
15 10 8 10 43 18 47 47 35 11 22 42 42 42 47 45 14
40 60 11 7 11 35 24 24 27 29 30 9 44 42 19 28 38
16 31 18 14 17 22 15 19 39 30 46 13 7 12 19 35 34
20 24 19 28 12 12 19 26 17 28 31 44 33 25 9 47 24
34 11 16 20 24 20 26 7 6 11 9 9 15 16 6 11 9
8 8 10 9 13 6 6 9 11 11 27 11 13 19 12 6 10
8 12 13 10 7 8 8 9 10 8 6 13 6 8 12 9 10
9 9 9 16 16 37 19 13 12 15 11 6 12 10 9 10 11
9 14 9 6 9 8 9 8 8 9 10 11 8 10 10 9 6
6 9 6 11 10 7 9 10 15 9 20 11 11 10 26 22 40
19 11 8 11 18 13 13 10 10 13 10 11 14 6 10 7 10
16 17 10 10 8 10 8 14 15 10 9 11 7 11 6 11 14
11 9 6 7 20 10 14 9 9 9 11 6 11 10 6 10 14
9 7 9 16 9 9 9 9 10 9 11 9 6 16 11 9 16
13 12 10 6 9 13 11 11 10 9 8 9 11 11 9 10 10
11 10 11 10 8 9 7 14 9 25 24 16 9 9 9 13 11
13 11 10 14 11 14 9 14 9 18 9 6 9 10 10 10 7
11 17 10 12 10 17 6 9 14 8 14 10 9 19 13 7 18
10 9 14 10 11 10 12 10 10 9 6 9 9 9 22 6 12
11 11 10 6 6 6 12 10 12 6 8 6 6 23 9 12 9
8 6 5 6 10 11 9 10 8 9 9 19 9 6 12 9 13
10 9 12 6 6 9 6 10 11 6 6 6 14 5 12 10 8
8 10 8 11 11 14 8 14 10 6 7 10 7 11 5 5 5