S03036-01_D16
Seqid S03036-01_D16
Sequence >S03036-01_D16.phd
NNNNNNNNNNNTCNNNNGNNNNNNCNNNNNGGNGATTGGNGGCCAATCGGCCGAATTGAA
AACTAAAGTTATGTATCTAAGAATTACAACGTAGTGTAGGTGAGCGGTACTTGAAACTTT
CTTTTTGTAAACACCATAAAAGGATATTAATGACATCGGTTGAAATAGTGACATCTAGAA
GGAAAATTACAACTAGAAGAAAGCGTGATTATGTTGTAAAGAATCCGGCAAATAGAAAAG
CTAAAAGATGATTGCAAGGCTAGTGAAGATATTTCAAAACTTAGTTACTCGTTACCTTAA
AAACCTTACATTGTTCTCATGTATTACATGAAATTCTATCTTTTCTTTTTGAATAAGCTC
TAAGTATTAATCCTTAAGTATTAATTGCCCACCACCTTCTTTAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAANGTACCGGCCATAAGGGCC
AGCTTGAGTATTCTATAGTGTCACCTAAATAGCTTGGCGTAATCATGGTCATAGCTGTTT
CCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACAAGCCCGGAAGCATAAA
GNGTAAAGCCTNGGGTGCNTAATGAGTGAGCTAACTCAATATTATATGCGTTGCNCTCAC
TGCCCGCTTTTCAGTCGGAGAACCCTGTCNTGCCAACTGNNTTAAAAGAATNGGNNAACA
CACGANCANACAGCACTTTGNNNAGGGGGGGGGAGNNANAGATACATGATTATTTATTTA
TATGCCTATATATTATCNCNATAAGGAGACGGACTATTNTAGTTACAATAGAAATAGGAA
ATATAAACANCACCCAANTACCACTATAACNCANAGGAGAGAGAGCNAGTGANAGACATA
TACCTTATAACGGGANNNTT
Quality >S03036-01_D16.phd
5 3 2 3 2 2 4 5 5 3 6 10 8 7 5 6 7
8 5 5 7 5 3 7 8 3 3 3 7 5 8 12 6 24
18 16 16 15 10 6 9 17 13 16 14 10 30 29 21 21 27
31 26 15 8 26 32 19 12 12 17 16 20 28 33 41 41 41
46 42 32 39 30 43 37 42 38 42 32 54 35 43 32 38 38
30 43 25 35 46 39 39 39 31 42 46 39 39 35 47 54 54
50 47 47 49 52 39 42 33 60 52 52 52 60 57 52 59 57
57 60 60 48 48 58 57 57 52 60 57 60 57 52 57 52 52
52 57 60 60 60 57 60 48 52 52 52 52 57 60 53 58 58
60 57 63 60 52 58 60 63 63 53 60 57 57 52 52 57 63
52 63 57 60 53 52 52 57 63 63 53 63 63 60 60 58 58
63 63 63 60 63 63 63 63 60 63 63 52 63 60 63 63 63
63 58 58 52 52 52 60 52 58 57 60 57 57 57 60 57 60
58 57 57 58 57 60 58 60 60 60 53 53 53 53 52 53 39
39 43 52 53 57 60 60 60 57 52 52 60 63 53 60 52 60
57 60 57 57 52 52 52 60 60 60 57 60 57 58 52 63 58
60 57 52 52 60 63 63 63 63 58 63 58 58 58 57 58 60
60 57 60 53 60 58 60 63 63 63 63 63 60 54 57 60 57
63 58 60 57 58 58 63 58 63 60 58 60 60 57 58 57 60
52 52 57 57 52 58 60 58 60 52 52 57 57 57 57 57 60
57 57 60 57 60 57 60 60 60 60 57 57 57 60 46 57 52
52 43 41 43 35 43 47 57 57 52 52 54 60 59 63 63 63
63 58 63 49 63 51 63 54 47 50 51 63 50 54 60 49 60
50 50 54 50 54 54 57 57 57 57 53 26 44 44 59 59 59
50 50 59 54 42 50 50 39 39 39 37 42 42 30 29 33 27
37 27 28 28 30 34 39 42 50 42 44 30 34 34 19 37 34
31 34 32 30 28 35 35 35 32 38 35 26 30 28 54 54 54
47 28 6 14 26 17 35 32 26 13 17 21 19 17 32 35 35
46 20 41 31 26 27 24 19 17 22 13 13 25 33 28 31 35
30 34 25 23 10 13 31 28 42 22 47 46 37 49 32 30 30
46 32 16 40 21 38 26 29 28 30 41 22 23 29 21 17 27
28 21 28 29 20 37 27 28 30 27 32 32 28 32 22 16 29
20 38 17 26 13 10 21 31 38 32 46 28 24 27 35 34 19
19 28 26 17 26 27 10 46 40 22 34 20 16 31 20 43 27
19 34 30 42 28 20 22 9 25 21 10 19 28 46 34 10 21
25 19 30 26 20 9 7 8 15 30 38 20 14 22 26 16 6
29 27 35 18 19 10 7 12 29 27 9 16 18 28 18 28 32
20 24 11 23 37 22 22 16 13 10 12 11 19 20 24 8 8
30 14 10 10 32 27 14 16 6 15 18 16 18 18 10 19 18
30 14 11 16 28 28 11 8 14 22 21 21 16 18 23 13 19
40 30 8 18 18 12 16 12 9 6 9 13 15 16 13 9 14
10 10 6 6 12 14 20 28 8 18 10 21 30 10 6 14 8
7 7 10 28 21 9 14 17 13 10 11 7 9 20 7 21 12
11 11 16 10 10 9 10 10 12 6 6 6 12 13 11 13 29
15 16 9 11 16 17 12 7 7 10 6 9 11 21 19 29 19
11 11 11 8 17 16 13 12 13 14 8 17 16 24 16 23 17
23 17 11 8 20 9 9 22 8 17 8 14 18 16 21 7 10
7 21 9 13 17 11 13 22 16 22 11 8 12 11 10 16 14
10 10 7 9 10 11 9 9 15 14 15 15 19 12 13 24 16
9 9 12 14 14 16 10 11 9 13 10 23 22 11 9 9 7
8 9 8 10 11 11 16 7 10 10 14 19 19 11 9 19 11
14 14 10 7 11 9 7 11 11 18 12 19 14 11 15 10 11
16 13 7 14 11 11 8 12 7 23 12 14 11 13 12 31 11
13 8 11 14 15 13 16 10 16 9 9 9 11 14 6 7 7
10 8