S03036-01_D17
Seqid S03036-01_D17
Sequence >S03036-01_D17.phd
NNNNNNNNTNNNNNGGNNCNNNNNNNNGGGNGATTGGCGGCCAAATCGGCCGAATTGACG
GCAAGAATATCTCAGGTCGGTGTCATTTCTAGGGCTCTACTTTCTTCTGTAAGTAGACGT
TGGATTCATGTAACGCCAATAAGTCTTAATAATTCAGGAGGATCACTATTCGGAAGCATT
ACAGAAAATAAACCAAAGGAAGGAAAAAACAGGGGGGATGAAGATGCAGGCAGCTTCTCT
AATAGGTTAGCGATTGCTTCTGATTCTTCTGGAGAGGCTCCTGAAGTTAATAGGGATTCG
ATAACTATAGAAAACGATAAACTACTACAGCAACATATCATATCTTTACAGCAACCGGAA
CAATTAGCATCACAGAGCTTATTATCTCCTTTGAAAAGGGAAATATATGAAGCTAATTGT
AAAATTAATGGTGGGTTTTACAAGAAAGATACTATTGTAAAGTTACCAAATTCTAGCGCA
CGTTACAAGCTAGAGTTAACAAAAAGAGAAATTGAAGTACTAGAACCTTCCGTATATGTA
CAGTCATATAGGAATTAAATCNTCNATGAAAAAGGCTACACTTTTGTTAAGGNTAATANG
ACGTCTCCCACCTANAAAAGCTGTGAGNGGGGGGCGCNTTTCTAATANGAAATTTCTCAC
NCAATAANAAAAAAAANNAGAAAAGGNGTTCNNANTGGTCCTAATTTNNGTTTGGNNNCN
NNNAATNCACAACCNCTTCACCATCTNAGCNGGGAGAGGNGGAGAGGNGAGAATNTTATA
TATTTTTTATTNNAAAGACAANAAAACNAATAGAANNCAGCCATNNANTNTAGTGTTTGN
GGATATNAAAAAAAAGAAAGNACACACTCACACGNCGCGCNGCGGTGGGTAGGGAGAGAG
GGATAGTAATATATTCTTCCANCAC
Quality >S03036-01_D17.phd
4 2 3 3 2 3 5 5 8 6 5 6 6 5 8 9 6
6 8 5 3 5 5 3 3 3 5 9 13 12 6 20 21 16
21 25 16 13 24 19 16 17 9 11 15 30 30 21 21 30 23
25 21 9 20 28 21 10 10 14 22 21 26 28 30 32 24 35
19 29 35 41 24 36 29 42 38 40 46 43 34 50 30 20 9
9 16 46 46 30 34 41 37 26 35 35 36 26 21 32 46 40
31 40 35 32 34 26 29 22 22 25 24 32 32 35 42 29 32
33 29 33 24 20 18 20 29 32 40 49 47 35 35 45 50 50
42 19 50 50 50 50 43 50 54 51 45 49 54 52 54 49 50
49 44 44 49 43 44 44 49 44 38 54 43 42 44 49 49 49
49 49 49 50 54 43 46 42 44 50 39 46 44 50 50 59 59
54 43 49 53 47 46 47 39 51 58 49 63 45 63 60 63 44
63 60 60 43 43 60 28 47 50 44 43 43 47 44 23 60 50
44 60 45 31 50 44 35 49 47 35 40 47 47 47 43 33 33
33 33 60 47 50 54 47 63 40 58 49 47 44 42 44 42 60
44 42 42 58 44 39 60 47 35 63 47 27 60 60 44 60 63
44 31 50 42 49 44 50 60 63 47 54 44 58 42 60 60 44
58 50 50 60 63 63 38 27 60 54 44 54 44 39 50 42 50
39 54 44 54 46 51 57 59 44 43 59 39 36 57 57 43 50
50 42 54 54 50 39 43 49 39 59 50 22 54 54 42 54 31
49 46 42 59 34 54 50 35 54 14 54 54 21 54 50 42 39
57 42 42 37 27 40 39 46 42 50 42 50 50 54 39 50 42
42 50 32 50 50 54 38 38 50 39 46 39 42 37 49 43 54
57 44 43 54 54 54 44 59 59 54 57 51 30 54 32 46 32
49 46 50 42 36 54 35 49 28 49 49 22 49 49 49 49 32
52 35 54 35 54 54 35 49 49 49 32 51 53 53 27 36 18
50 50 35 49 49 35 46 16 35 36 36 52 22 21 21 14 14
53 35 28 27 40 29 43 43 13 27 27 23 35 33 20 25 16
49 11 8 19 27 20 25 29 28 28 27 37 28 26 10 10 8
13 28 26 35 30 31 24 28 28 32 34 32 21 49 16 50 41
28 21 42 33 33 43 32 28 21 16 26 22 10 31 40 26 37
19 37 30 30 30 25 35 22 18 18 20 14 9 13 30 29 18
11 15 19 28 14 14 15 23 24 28 10 26 21 30 34 26 26
5 18 20 6 25 18 15 30 27 28 41 44 20 42 23 38 30
28 17 23 20 27 14 21 18 17 19 30 21 12 21 7 14 18
14 11 18 7 12 22 19 25 14 28 17 27 24 19 9 19 11
10 10 6 10 25 13 13 27 12 12 16 11 9 9 9 7 10
8 10 10 20 17 8 8 9 7 14 17 28 11 11 12 19 21
26 7 10 16 19 19 19 21 20 12 17 17 12 16 7 11 27
17 10 12 18 7 17 17 26 26 20 8 13 16 6 5 12 16
20 17 23 45 10 18 6 9 10 9 9 7 7 12 6 11 11
16 13 10 13 12 11 9 8 13 16 7 6 15 20 14 14 11
8 7 6 6 20 5 5 6 6 9 9 9 7 8 14 10 16
12 12 11 7 12 11 8 20 10 16 16 10 12 10 10 7 11
8 10 7 13 20 8 8 8 12 18 11 7 9 30 13 27 13
13 17 6 25 21 19 14 10 10 6 10 10 8 8 13 22 13
25 30 19 21 16 23 15 13 8 6 6 9 27 11 11 29 16
23 12 7 15 10 16 12 9 6 18 20 12 14 14 27 11 6
7 9 8 19 15 14 11 10 6 6 9 6 10 7 16 8 8
9 8 11 11 10 9 6 11 12 21 29 19 16 5 17 18 21
24 9 19 17 29 15 9 10 16 11 7 12 11 11 10 8 17
11 8 8 13 8 11 8 7 19 11 8 8 8 7 12 10 8
11 11 8 10 19 13 10 10 16 18 10 21 10 21 13 17 9
14 18 8 13 10 14 13 10 13 10 20 27 16 11 8 8 8
9 9 9 7 9 12 11