S03036-01_D18
Seqid S03036-01_D18
Sequence >S03036-01_D18.phd
GNNNNNNNNNNNNNTNGNNCNNNNNANANGGNGATTGNGCGGCCAATCGGCCGAATTGAC
AGCAAAAACGTTAAATAAATCTAATAAGATTTCATTATAACATAACATTAAAGCACACAA
ATTTCTAACACAAACACAATTCAAACATGACCAGAACTAGCAAATGGACAGTCCACGAAG
CAAAGTCTAACCCAAAGTATTTCACCCATAACGGCAACTTTGGGGAGTCTCCCAACCACG
TCAAGAGAGGAGGCTATGGGAAAGGCAATTGGGGCAAGCCTGGCGATGAGATTAATGACT
TAATCGATTCTGGCGAAATTAAGACAGTCTTCAACAAGACCAGAAGGGGCTCTAACTCCC
AAAACAATGAAAGAAGGCTTTCTGATTTGCAACAATACCACATCTAACCGACCCGACCGG
TTTGATTCCGTTAGCATATTTCAAAGAAACGGGCCTTTTAATGATTTAACGACCATATCA
CTTCAATAACGTGTATGCATATATAAAATGATCATGTCAAACATCCTTTATATTACTTCT
TAAATACATGTTTACGATAAAAAATAAAATTTNAAAAAAAAAAAAAAAAANAANAAAAAC
NANCAGNCCNAGAGAAGGAGGNTGGGAAGAGATATANAATNTTTTTATTAGTTGGTCCGC
GCATAAGGGGNGAGGGTGGGGGTNCTCATNAGTGGGCCCCAAAANANTTTGGNANAANNA
GAANCCCACACTCCTCCCCGCGCNGANNGGNNNNNGGGAAGAGAATNCGNAAAAATTNGN
ATCTNGAACTAAAAAGGGAAAGACNGGGGGGGGCAGGGANGGNAGTGAAGCCGATNNNTG
TGAAGAGAAAANANACACCACACACACCAGACACNCGGGGAGGGGAGGAGANANGAGAGA
NANACNAGAGTNGNAANAAA
Quality >S03036-01_D18.phd
9 4 4 3 6 3 3 3 4 3 3 2 3 3 8 5 8
5 5 9 5 3 5 5 5 13 5 9 7 13 14 7 22 22
14 24 24 7 12 10 21 23 15 9 9 9 29 28 30 25 36
30 30 28 11 26 31 18 13 18 13 16 27 19 21 28 22 29
24 14 29 42 30 34 34 32 35 46 35 42 40 36 37 40 21
19 15 15 28 28 49 49 31 15 32 33 30 30 25 29 32 27
41 32 28 35 28 42 28 27 26 25 35 30 24 28 33 30 19
20 26 33 40 43 42 44 42 50 50 50 50 42 39 42 50 42
54 43 49 46 49 44 42 42 59 52 50 59 54 45 50 45 45
49 51 53 63 63 58 47 45 49 47 49 54 49 47 44 50 47
49 50 59 52 59 50 47 50 54 50 50 60 47 60 54 49 51
50 60 60 49 43 63 51 63 63 63 63 58 52 63 63 51 50
63 63 51 50 51 50 51 46 43 47 49 60 60 47 60 60 50
50 50 60 60 52 57 57 54 52 57 60 42 40 42 57 52 47
57 40 52 46 35 47 52 52 63 52 63 63 58 52 63 52 63
60 59 52 57 57 52 60 60 57 52 57 60 57 52 63 63 63
63 63 60 60 63 58 63 60 58 63 63 52 63 52 52 63 63
52 52 52 58 60 60 52 58 52 57 60 63 57 60 57 57 57
58 52 58 60 63 63 63 52 57 63 60 52 52 58 57 63 57
58 60 52 63 60 60 58 58 52 50 51 54 50 60 47 39 47
49 47 44 46 47 40 43 43 42 44 49 49 49 49 49 49 49
60 43 47 47 44 46 46 49 49 49 60 63 57 63 63 58 63
63 49 45 44 63 63 63 49 50 49 47 47 63 50 50 60 47
49 49 49 60 60 54 50 50 50 58 50 54 60 54 60 63 54
63 60 63 54 60 63 54 50 50 51 49 63 50 60 60 60 50
42 58 49 49 44 50 51 47 60 60 54 54 54 50 53 53 50
42 50 57 50 49 49 54 49 49 54 57 42 49 49 49 49 44
42 50 42 49 49 39 49 43 42 43 44 39 44 46 46 35 49
44 49 54 31 50 49 43 29 35 30 31 39 42 42 50 36 38
35 32 27 42 31 44 49 46 50 50 57 43 54 50 50 50 54
43 54 30 37 54 59 54 43 34 42 50 43 50 50 42 50 44
50 42 54 23 44 31 50 54 50 43 42 43 44 44 50 32 32
42 42 34 23 30 54 31 42 43 54 42 34 49 34 31 39 39
42 42 24 19 32 30 44 38 41 50 26 6 22 19 39 11 28
13 24 19 32 35 27 21 25 24 11 21 18 7 12 10 6 12
12 10 10 9 9 7 11 6 9 12 10 7 9 9 6 12 16
18 13 10 15 12 16 8 15 16 7 9 16 9 17 14 19 20
15 13 8 14 12 10 17 6 16 10 17 6 12 21 11 9 9
10 14 17 11 9 9 8 10 11 9 16 16 8 8 8 11 16
14 14 17 23 19 28 12 7 8 8 11 11 14 12 18 8 12
12 16 18 7 10 16 11 10 19 6 15 14 8 11 15 10 26
16 20 11 23 19 22 12 6 26 6 10 15 13 22 13 6 8
6 35 15 7 7 12 12 15 15 7 8 9 8 8 11 9 15
9 12 8 12 11 18 18 18 10 11 10 10 7 8 11 7 7
14 12 7 6 6 6 7 13 22 11 11 8 8 8 15 15 11
11 7 8 8 7 11 19 20 27 19 16 18 6 11 7 20 11
16 13 7 10 12 14 12 14 11 11 20 15 10 13 12 11 11
19 19 17 8 8 6 11 28 22 30 9 19 11 9 11 10 11
9 12 9 6 13 18 6 15 15 11 13 18 12 20 16 12 15
28 8 7 6 7 26 18 17 20 14 13 10 28 8 13 15 12
15 6 21 6 8 9 10 15 20 19 11 12 12 15 10 10 10
10 15 10 10 10 10 9 6 10 21 27 27 14 9 18 30 19
13 11 17 11 12 9 13 7 8 7 9 20 8 13 13 19 7
12 6 16 12 6 13 11 33 17 9 5 9 7 10 10 5 9
22 15