S03036-01_D19
Seqid S03036-01_D19
Sequence >S03036-01_D19.phd
NNNNNNNNNNNNNNAGGCCCNCNNNANNGGCGATTGGCGGCCNATCGGCCGAATTGAAAT
AAATCTAATAAGATTTCATTATAACATAACATTAAAGCACACAAATTTCTAACACAAACA
CAATTCAAACATGACCAGAACTAGCAAATGGACAGTCCACGAAGCAAAGTCTAACCCAAA
GTATTTCACCCATAACGGCAACTTTGGGGAGTCTCCCAACCACGTCAAGAGAGGAGGCTA
TGGGAAAGGCAATTGGGGCAAGCCTGGCGATGAGATTAATGACTTAATCGATTCTGGCGA
AATTAAGACAGTCTTCAACAAGACCAGAAGGGGCTCTAACTCCCAAAACAATGAAAGAAG
GCTTTCTGATTTGCAACAATACCACATCTAACCGACCCGACCGGTTTGATTCCGTTAGCA
TATTTCAAAGAAACGGGCCTTTTAATGATTTAACGACCATATCACTTCAATAACGTGTAT
GCATATATAAAATGATCATGTCAAACATCCTTTATATTACTTCTTAAATACATGTTTACG
ATAAAAAATAAAATTTACATTATNAGGGGGGGGGGGGGGNGAAAAAGAAAAAGAGAAAAA
CACCCAGCCCCNCANCGCNGANGGTGCGGGGGGGAGAGGGGGTNNTTTTTTTTTTTTTTT
TATGTCCACCTAAAAAGGCGGGGGGNGAGGAAGGGGTAGNACGTTTTCCCGGGNGAAATT
TNAAAAATACACAAAAAAACACGACACCTTAGCGGACGGAGGGGGGGGGGAGGAGCGGGG
GGGGGCCTTTTTNNNNACTTATTTATANGTAANNTGGAATGGTGAACGACTGCTTTCNCA
TATNGGGAANGAGTAGGTTAAATGAGAAACAGAACGCACACACACCNCCCGGCCGCCGGA
GGGGAGAGGGGGGGGGAGGGAGTTTTTTTAA
Quality >S03036-01_D19.phd
5 5 5 5 5 5 6 6 7 7 5 5 5 7 8 8 12
9 10 9 6 8 3 5 5 9 7 5 16 14 9 15 30 19
19 29 25 29 34 27 11 10 7 9 24 30 26 29 29 28 25
24 12 30 31 24 14 24 21 28 18 30 36 28 38 38 35 38
40 28 29 28 31 16 32 28 28 26 42 35 41 33 22 21 28
9 21 19 21 35 25 31 31 22 19 25 26 35 19 37 27 42
31 44 27 33 37 26 27 22 22 31 30 18 28 18 22 35 39
30 43 39 35 43 49 44 44 39 42 42 36 46 44 33 32 44
38 39 44 42 46 44 44 43 30 39 39 43 54 50 47 44 39
41 22 23 43 35 42 42 28 35 29 39 44 29 29 32 19 44
50 44 47 42 47 47 42 42 42 40 43 47 60 44 60 54 42
32 40 60 40 35 44 43 43 43 41 22 43 36 41 43 43 41
50 50 50 49 46 42 35 44 47 39 50 63 33 21 42 60 63
25 59 35 41 47 25 50 49 45 42 50 58 63 47 31 44 15
19 19 19 30 43 38 35 20 21 30 41 17 47 49 60 49 60
46 60 47 47 44 44 47 49 49 47 47 60 35 60 50 24 47
50 22 45 19 51 47 49 42 60 39 44 44 47 40 47 49 50
44 47 44 49 49 35 54 63 14 60 42 42 43 47 60 24 33
32 47 24 35 50 44 60 42 43 42 27 45 44 33 50 42 42
24 47 35 35 42 43 26 63 58 49 29 47 42 42 35 47 40
42 42 41 41 24 47 43 33 44 13 42 43 60 42 47 41 44
47 54 47 63 27 47 60 60 60 47 60 44 27 46 43 42 28
27 46 34 21 43 54 44 39 54 42 49 39 49 42 50 39 54
39 49 42 54 34 50 49 43 50 27 54 43 57 28 53 53 43
44 22 49 27 49 39 50 54 42 42 42 42 39 42 22 49 49
36 22 44 54 18 36 39 50 50 27 49 49 22 46 39 50 54
50 16 49 27 36 21 22 49 45 22 31 21 15 39 22 36 28
27 22 22 22 39 31 39 43 28 9 22 26 12 15 18 10 35
42 22 27 27 28 27 10 28 22 29 21 27 13 35 22 22 27
29 21 12 18 13 21 27 13 10 9 23 19 22 16 22 19 22
16 38 39 18 32 19 28 39 22 27 19 44 17 31 32 19 34
39 28 19 29 14 21 17 15 20 13 14 15 11 39 17 31 39
39 35 31 20 14 13 22 29 13 12 17 35 22 31 15 27 31
11 18 7 11 9 14 11 10 19 16 27 10 11 10 10 13 13
10 7 23 14 15 36 28 14 11 12 9 15 35 27 14 17 9
20 26 12 12 18 9 9 11 10 16 14 12 11 11 11 16 7
10 13 7 11 12 10 6 10 10 7 13 19 15 15 16 20 31
28 31 34 20 21 17 19 31 31 28 39 22 13 8 6 6 9
13 14 10 9 14 21 28 17 29 14 21 20 16 12 13 12 23
23 11 13 12 11 19 23 19 29 18 18 17 14 10 9 11 16
25 28 21 18 15 6 13 12 13 13 18 17 17 25 29 12 11
10 9 6 12 12 12 14 24 14 14 11 10 11 29 29 22 7
19 12 23 9 10 15 19 6 11 11 14 17 19 9 10 8 11
9 13 13 25 26 13 14 15 9 14 14 10 11 23 19 15 14
14 9 10 11 17 13 19 9 9 28 14 16 11 14 18 14 11
14 12 34 16 32 19 32 11 9 36 12 18 34 18 47 34 36
22 28 22 8 8 9 18 23 14 14 6 6 7 6 14 11 9
11 14 11 21 11 19 18 32 7 12 11 10 14 6 6 9 11
15 11 14 17 12 10 11 14 11 13 11 11 19 9 10 18 8
13 14 9 13 7 21 21 15 15 10 6 9 18 28 11 10 7
11 16 21 12 18 14 14 8 9 9 10 20 11 14 14 11 11
18 20 11 20 19 28 12 14 19 14 17 11 11 13 16 10 11
10 9 6 11 32 16 15 11 15 11 14 14 13 24 19 17 9
14 22 28 19 16 12 9 40 19 32 32 28 40 32 13 9 11
14 18 11 11 14 15 18 19 19 16 16 16 9