S03036-01_D20
Seqid S03036-01_D20
Sequence >S03036-01_D20.phd
GGNNNNNNNNTNGNNCTGNCCCCAANNCTNNNGGNGANTGGCGGCCAAATCGGCCGAATT
TACTATATTATATATATATATATGTATATATATAAAGGGAGGAGTTTTTAATTATAATTG
TAATTTCGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAANAAAAAAAAAGANAANAA
AAAAATAAAAAAAAAAAAAAAAGGTCCCGGCCATAGGGGCCNCCTTGAGTATNCTATAGT
GGCACNGAAATAGCTTGGCNTAATCTGGGTCATACCTGTTCCCGGTGGGAAATTGTTATC
CGCTCACAATTCCACACAACTACCAAGCCGGAACCATAAAGTGTAANNCCNGGGNNCCCN
AATGGCCCCCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCTTTAATGATGGGCCAACG
CGCAGGGAGAGNNCGCNCCCCTATTGCNCCATGGGGGATNGGAGGGTAATGGACTTTTTG
TTTCTTTTCTTCANATACAGAAAAGAGGAGCGGCTGCCCTACAGTGGGTTTTAGGGTTGT
GGAGGGGGGGGGGGAGGGCGTANTATTTATATATTCCACTATACGGGGATAGAAGAGGAC
CCCGCCCCGCGTCGGGCGATCGTGAGATAGTAAAAGAAACACACCCCCCCCCCCCAAAGG
GGAGGGGNNGGGGTACATTTTTTTTTATCTTTATTGAAAAGCAAGAGACCCCGGGCGGGN
GGGGGGCTGNGAAGGAGGNNAGNAGANGAAAAAAAAGNCCCACCCNCCCCCGCACGAGGG
AGGGNGGGGGGGGGGNGATGTGAGCANACNTNAA
Quality >S03036-01_D20.phd
14 8 3 7 3 3 5 6 6 5 8 7 9 6 6 9 9
11 7 8 9 10 18 9 9 7 5 11 8 6 6 7 27 10
6 8 8 6 8 16 12 21 22 9 13 18 13 13 16 39 35
22 15 30 28 21 26 9 26 40 26 22 25 23 16 48 42 46
32 46 46 39 48 42 52 46 42 35 35 42 47 57 52 46 42
47 44 35 34 25 32 44 44 35 42 39 42 40 35 28 22 31
28 26 35 34 35 27 19 27 26 18 20 15 15 15 21 21 26
37 21 27 33 33 35 32 47 43 42 49 49 49 46 37 46 41
37 37 46 35 35 35 35 28 29 29 27 28 34 36 34 37 42
32 28 21 25 23 29 20 15 26 7 22 16 15 15 11 12 9
11 9 16 12 6 9 9 6 23 20 16 16 15 15 27 17 31
30 36 30 26 26 17 28 24 28 27 41 35 30 47 40 14 29
21 29 33 23 19 11 15 25 26 13 40 9 41 28 15 26 29
7 9 11 26 23 26 14 16 20 12 15 7 12 21 31 14 9
45 8 35 16 17 10 13 5 9 15 21 19 18 9 14 16 17
9 24 27 14 7 25 27 12 14 17 9 8 40 16 18 27 14
16 20 15 31 19 22 25 12 9 27 21 12 27 10 22 13 13
45 34 28 33 31 42 23 26 11 11 26 21 20 13 9 19 29
28 16 18 21 28 28 25 15 23 26 9 21 18 11 8 9 8
21 15 28 9 21 37 19 9 19 11 9 16 28 20 40 42 41
20 24 31 19 28 26 6 6 17 20 7 10 13 8 6 6 9
13 23 7 28 14 10 21 20 27 60 36 20 25 28 29 19 46
13 23 10 28 46 27 53 12 37 37 41 44 13 13 24 13 26
27 11 28 37 20 27 14 17 21 17 27 53 53 53 19 9 9
11 16 11 11 13 42 37 8 53 57 19 14 32 9 19 19 18
34 10 53 10 21 9 6 7 9 14 13 7 9 20 25 14 20
13 40 11 10 11 6 29 12 9 12 11 20 14 23 9 14 9
6 11 23 11 47 15 32 11 11 16 11 16 16 22 10 23 8
34 32 24 11 10 15 14 9 11 15 24 22 14 14 9 10 8
6 9 10 13 14 24 19 12 13 20 11 12 12 19 22 17 10
10 13 22 23 9 14 10 15 13 9 11 9 14 18 9 14 15
15 17 13 8 10 11 9 23 19 24 16 16 11 27 53 10 14
46 46 32 28 32 28 32 15 13 25 11 25 23 14 8 10 11
14 7 10 16 13 10 10 11 14 11 11 10 19 14 20 17 10
9 9 23 9 9 14 11 10 8 8 14 15 19 11 11 11 36
11 18 16 14 11 14 11 9 11 14 14 28 11 13 9 28 17
11 16 18 23 15 19 18 23 9 22 14 19 13 14 10 9 11
10 10 8 32 14 14 11 15 40 34 12 14 37 17 11 14 22
32 23 28 50 24 21 14 14 15 10 11 15 14 12 10 23 11
16 15 19 15 6 7 14 41 24 15 11 11 9 9 11 15 14
17 21 22 14 11 14 14 23 11 18 17 14 10 12 11 11 12
12 11 13 12 9 14 19 15 12 14 15 14 11 11 9 14 23
24 11 11 15 10 7 16 8 15 14 21 14 15 10 9 6 13
13 12 32 28 14 9 14 6 7 11 9 6 18 9 9 6 9
11 11 11 11 15 32 18 14 14 7 10 8 9 13 11 11 9
7 12 32 32 40 18 14 9 40 11 11 17 16 19 13 20 29
14 11 7 28 17 16 20 22 9 14 9 15 10 7 14 14 11
14 11 11 8 23 9 14 5 14 9 5 11 6 14 21