S03036-01_D22
Seqid S03036-01_D22
Sequence >S03036-01_D22.phd
NNNNNNNTTNNNNNCNGNCANAANANNANAGGNNGGATTGGCGGCCAAATCGGCCGAATT
GGTCTCACCTACTAATACTACTTATCTTTATAACGATTATTATTGAAATGTGTTTATATA
ATAAAATTTTTAAGAACCAAAGGTCGGATGATATTAGAGACAACTTTAACAATGGCGGAC
ATCGAGTTCCCAGTAATGTCCAAAATCATGGAACCCATATAAGAGACGAAGCCTTTATAT
CAGGGGTCTATTATTCCAATTGGTCCCCATACAAACCGAGGTTTCATTTCCCTCACGACA
TAAACTTGAAGCAAGTGTCTCATATTTACTATGCATTTTTCAAAATAAACTCTAGAACTG
GTGGTATAGAAAACACGGATAGTTGGTCTGATCTAGAAATGAATTTGTATAAATCGCTGG
CAATTAAAAATTCAGAACTGGTTAAAGAAAGCTCGAACAATAGTGTCCCAAACATCCTAC
CCTTAGGGTGNAGGGGGNGANCGATTCTATNTGAAATATACTTGATANGAAAAAGAAGNT
GGGTGCGGTCAAGGAGCTCTGGTGGGCTTGTCTGGNNAGTAANANAANAAAATGTTTCCC
AACCCAGCTGNNGGGGAGGGGGGGGGAGGNGGAGATTGGTATAGATAGAGATTTGTAAAA
AGGGAAGGGAATGGATGGTGGGGTCAGGGATTNATTTAAAAAAGNGGANATAAANATNNN
AATATACAAANNGGCANAAGGAGAAAAGAGAANNAAAGGAGGGTGNTTGTNNNNGGTTNT
CNAAAGAAANAAGAGNANNGGAGCANNTTTTGTAGGNNGNATAGNGGGGTNGAAAAAGAA
ACAAACGCAGAAAGCCAANACTNGNGCNAANGAAGGTCTGGTNATNAAN
Quality >S03036-01_D22.phd
4 3 3 3 3 2 6 8 8 5 7 6 5 6 8 5 8
7 8 9 6 8 8 7 8 5 5 8 5 12 8 14 7 6
16 10 24 17 16 24 10 15 28 19 10 17 11 9 10 30 31
27 28 28 30 23 27 17 35 26 15 10 24 22 35 29 22 21
33 28 22 36 28 20 35 39 33 31 28 27 35 27 31 42 44
47 30 27 22 22 29 39 42 47 32 44 35 19 22 21 17 23
32 47 42 37 35 37 29 42 21 35 22 21 20 34 30 22 28
28 35 41 46 35 41 37 42 60 60 60 43 47 42 44 57 39
52 52 42 46 46 52 57 57 52 47 47 52 52 57 48 52 59
52 52 52 60 58 52 48 46 48 48 48 48 60 52 47 52 52
46 42 60 52 52 46 60 57 48 41 42 57 60 46 46 57 57
52 57 60 52 48 52 48 48 52 52 57 57 57 52 52 60 48
43 48 48 48 43 57 60 44 57 57 43 35 40 57 46 47 42
46 47 60 47 52 52 52 46 47 60 57 60 47 60 40 46 60
46 42 42 39 44 63 52 52 44 42 34 40 52 52 60 52 47
42 42 52 60 52 52 52 52 47 52 52 43 40 40 46 60 57
47 45 40 43 43 52 63 58 63 60 57 52 60 47 52 57 52
57 60 57 57 57 47 52 60 52 60 57 52 52 60 57 60 52
57 57 52 57 60 57 57 52 60 60 60 46 42 46 57 57 57
60 52 57 52 47 52 42 60 57 60 52 47 52 60 57 57 42
52 24 42 47 47 42 46 42 42 60 60 60 44 42 47 52 52
60 52 52 52 47 52 57 42 57 60 52 57 57 60 57 44 44
57 52 57 52 35 52 52 46 60 57 42 52 57 52 44 42 34
32 32 35 47 29 47 36 40 46 52 57 60 29 46 42 42 9
11 20 42 60 42 46 52 52 28 39 39 42 28 19 41 46 44
42 35 22 35 41 57 52 39 26 15 52 44 32 39 43 35 35
42 23 35 32 46 32 42 44 41 19 29 22 31 41 46 46 20
27 32 28 14 26 35 11 20 19 10 12 12 16 34 16 11 9
13 10 23 28 41 13 11 16 10 32 37 20 14 28 7 11 10
10 20 19 13 7 11 11 7 9 10 11 14 11 22 19 28 11
6 8 12 14 23 9 11 11 10 19 10 11 18 9 9 9 9
6 8 11 11 18 13 24 11 26 16 9 6 14 9 10 14 10
22 8 10 9 9 10 10 9 9 11 13 10 11 16 9 9 13
14 13 16 14 13 11 14 9 9 9 11 16 22 11 6 6 9
11 8 13 27 7 13 6 9 10 7 9 10 25 18 9 18 22
13 10 10 11 9 9 10 9 11 17 11 10 10 9 10 6 6
10 15 19 15 12 19 9 14 14 11 10 11 10 18 10 11 12
7 21 13 9 18 10 9 10 14 12 11 9 12 9 9 9 10
10 9 11 11 8 18 13 10 9 11 13 9 17 14 8 9 11
11 24 15 12 13 13 9 11 10 11 9 9 10 10 11 10 11
16 10 14 10 8 9 15 12 9 9 10 14 6 9 9 9 20
15 9 12 13 10 9 9 6 10 9 24 7 15 10 32 14 11
6 10 8 6 6 6 9 18 11 10 11 11 12 18 28 11 6
6 10 9 11 14 6 10 11 10 14 11 9 10 10 9 9 11
13 9 11 9 6 6 10 9 9 13 11 11 15 16 11 9 11
7 11 10 11 12 6 6 6 6 9 15 10 14 6 9 11 6
9 19 24 19 18 10 11 6 14 11 11 14 16 7 18 7 6
9 10 8 10 10 11 7 6 11 10 11 12 12 9 11 9 16
6 6 9 6 9 10 12 13 7 22 13 13 9 10 6 9 10
18 9 26 9 9 20 16 19 8 19 20 16 10 11 9 9 9
11 9 14 8 11 10 9 10 6 9 10 8 6 8 6 19 9
6 11 25 6 8 10 13 8 9 10 9 9 12 14 8 6 18
11 6 14 11 6