S03036-01_D24
Seqid S03036-01_D24
Sequence >S03036-01_D24.phd
NNNNNNNNNNNNNNAGNNNNNNNNNNNGGGCGATTGGCGGCCAATCGGCCGAATTGACTT
GGACGCTGTTCAATAATGTATAAAATTTATTTCCTTTGCATTACGTACATTATATAACCA
AATCTTAAAAATATAGAAATATGATATGTGTATAATAATATAAGCAAAATTTACGTATCT
TTGCTTATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAANAAAAAGAAGAG
AGAAAAAAAAAAAAAAAAAATAAANAAAAAAAGGGTCCGGGCCTAAGGGGCCGGCTGGNG
TTTTCTATAGTGCCCCCNAAAAAGTTGGGCNAAATCNGGGCCATAGCTGTTTCCNGGGGG
AANNTGTTATCCGCTCNNATTTCCNCACAACNTTNNGNCCNGGAAGCNNANNGNGAAAGG
CCNGGGGNGCCTANNGAGTGNNNCTAACTNACANTANTTGNCGTTNCNCNCACTGGNCCC
GCTTTCNGGTCGGGAAANNGGTGGTGCNNNNTNNTTNANNGATCCGGCNNACCCCCGGGA
AGAGGCNGTTTGNCGTTTTGGGGNGTTNTTNCGTTTCCTGGGNTCANNGAATAGTTGCCA
TCGGGNNTTCGCGNTNCGGGGGNNGGAGANGAGNGNANCTAAAAGGTGATATTCGGGTTA
TCCCACTAACTANGGAAACNCGTGGGATAGAATNTTGNTNGNNAGGGGCAGGAAAANNGN
GGAAACGGCACACNCCCCCCTGCGCGCGGGGGGGGCAGGGGGGGACCNNGNGGGGGCTAA
TTTCANANNACGGCACCAAAAACAGAGGGGGAGGACGGGCGCNCTCTGGTGGGGGAAAGG
GTATTAAGGGGGGCTCCCCCGCGGCTCTCACTGCGGGGGGGGG
Quality >S03036-01_D24.phd
5 3 4 3 5 5 3 2 3 7 3 3 5 5 8 8 3
5 5 6 5 5 3 3 3 5 5 9 18 13 9 10 12 15
22 25 14 17 31 26 13 22 8 10 38 21 23 21 31 30 27
28 9 23 28 27 16 26 50 35 41 50 20 21 43 35 39 38
54 44 27 18 47 44 44 39 45 53 46 43 44 22 28 29 31
34 60 33 44 50 60 42 45 52 40 60 52 52 44 29 36 32
39 42 63 35 25 34 21 40 35 42 46 46 52 42 46 52 48
46 60 47 60 57 57 48 42 35 42 52 46 57 57 57 47 47
57 60 52 54 57 54 60 52 57 60 58 63 60 63 63 60 63
58 63 63 57 52 60 60 57 52 57 60 52 52 60 57 52 52
63 52 52 52 60 52 57 60 59 63 63 52 52 60 57 63 52
63 46 57 60 60 60 60 60 60 60 60 58 60 57 57 60 60
60 60 60 60 60 60 60 60 60 44 44 44 44 60 42 39 39
36 22 17 22 16 22 9 6 10 11 11 11 10 9 9 9 11
9 14 9 11 9 10 13 22 26 30 29 31 31 29 28 20 19
16 16 22 18 15 9 12 15 15 5 27 28 33 24 26 33 8
8 15 9 12 22 20 14 14 12 16 17 13 13 16 20 36 35
13 32 26 13 12 13 20 17 22 7 9 18 20 26 23 17 16
9 13 14 16 10 12 13 23 21 29 21 7 41 20 19 11 14
14 12 24 14 30 14 9 7 10 10 13 10 11 6 18 29 16
9 12 12 10 10 11 12 12 13 22 20 8 18 21 7 33 25
27 14 13 9 17 6 7 10 17 16 14 12 8 27 14 8 13
12 18 7 6 11 11 22 17 12 11 6 17 10 11 19 20 10
6 15 11 6 5 8 5 8 14 7 27 10 8 12 10 12 6
6 11 7 7 10 7 12 13 18 19 8 11 13 12 6 25 33
37 14 7 11 16 27 9 13 7 7 14 10 18 10 13 7 7
7 10 10 10 10 9 11 6 9 8 9 7 9 27 6 23 18
10 5 12 9 25 11 7 8 7 10 7 16 10 17 9 10 9
6 32 15 12 11 14 26 15 11 19 7 13 20 8 8 19 22
9 10 17 16 7 5 11 14 10 20 19 8 14 9 7 3 2
7 10 6 7 26 19 7 12 7 7 8 21 13 9 11 12 15
24 7 6 14 8 17 16 13 12 15 30 21 8 13 8 10 19
11 8 7 25 13 25 13 12 7 11 13 15 13 25 29 22 34
30 10 6 9 9 15 7 10 19 7 9 8 22 22 16 11 8
20 14 19 17 7 9 8 17 7 7 8 9 10 10 12 10 17
11 12 12 17 12 11 14 12 9 11 7 6 10 15 15 9 12
11 7 9 6 8 12 19 17 8 8 7 6 16 20 8 15 15
6 12 11 11 7 10 7 16 6 12 16 19 13 27 14 12 9
10 19 9 14 13 13 15 10 16 10 8 30 27 14 18 14 18
13 11 10 12 23 12 11 10 9 7 29 16 18 13 11 11 7
14 8 10 17 19 15 16 10 30 21 9 11 11 7 11 13 12
6 9 7 10 6 7 26 18 30 19 17 8 11 14 13 14 19
19 32 6 5 8 6 15 11 10 10 8 8 8 11 11 19 8
10 13 7 10 10 11 14 14 10 10 12 8 12 9 16 13 21
10 15 11 9 9 14 15 15 11 13 14 17 14 11 14 11 11
11 9 6 6 10 7 18 19 27 12 14 10 10 15 9 14 20
19 21 10 7 11 6 7 13 10 16 10 14 15 11 10 18 13
11 22 11 13 13 22 11 16 15 24 13 15 12 19 12 13 20
19 18 15 8 11 10 6 11 14 9 14 17 20 20 17 14 14
20 22 18 16 13 17 15 19 14 13 9 10 11 14 15 27 23
28 28 17 19 19 16 17 16 16 17 17 12 16 24 20 16 17
20 18 16 17 18 17 17 17 27 10 14 13 16 22 28 15