S03036-01_E03
Seqid S03036-01_E03
Sequence >S03036-01_E03.phd
NNNNNNNNNNNNNNTNNNNNNNANNNNAGGGCGATTGGCGGCNATCGGCCGATTGGGGGA
GAATCAATAACAAAATTGACGACATTTCTCTAATTGGTAGATTACTGATATGCGGCAACT
CTGTTGACTTCGACATTAAAAGCGTGAACAAAGACGAATTGATGATTTCTCTAACTGAGT
TCAGTAAATTTCTACACAACATTTTGCCATCTATATCTGTTGATATTATGCCCGGAACCA
ATGATCCAAGTGACAAATCTCTACCGCAACAGCCTTTCCACAAATCATTGTTTGATAAGT
CCCTAGAATCATACTTCAACGGTTCTAACAAAGAAATTTTGAATTTAGTGACCAACCCAT
ATGAGTTTAGCTATAATGGCGTAGACGTTCTAGCCGTTTCAGGCAAAAATATCAATGATA
TTTGTAAATACGTAATACCATCAAATGATAACGGAGAAAGTGAAAACAAGGTCGAGGAGG
GCGAGAGTAATGATTTCAAAGACGATATAGAGCATCGACTGGACCTTATGGAATGTACAA
TGAAATGGCAAAACATCGCGCCCACCGCACCTGATACCTTATGGTGTTATCCGTACACTG
ATAAGGATCCATTTGTATTGGATAAGTGGGCCCCACGTTTACATTGTGGCAAACCAACCA
TATTTTGGAACAAGAGTATNGAAATAGGTGGGTAAGAANATAAAAAAAAATATCTGTCCC
TGAATTCAGTTCCACCGGGGANAGATAAAATTGCATGAATTGGAAACTTANAAAGAAGAA
ACGGCCAGAAATGGACTTTAAANAAGAAGANGCANTGACGGGCGACGGGCGGGGGGAGGG
GGGGGATTGNGAAAAAAAAAG
Quality >S03036-01_E03.phd
5 2 2 2 3 3 2 2 3 5 3 3 4 6 8 3 7
3 3 3 5 7 11 5 5 3 3 8 8 17 26 13 26 22
16 29 30 14 14 42 10 9 7 24 41 30 36 24 30 29 30
23 13 33 30 17 29 31 36 24 17 28 23 14 34 23 21 38
49 42 31 23 26 45 30 36 49 49 42 32 30 35 46 27 34
46 46 46 40 40 26 29 27 30 37 41 30 41 46 49 42 29
43 54 41 46 49 42 37 37 38 40 45 53 42 39 50 49 39
51 49 51 49 47 50 42 32 28 49 50 54 42 34 43 54 52
45 39 50 50 50 50 57 57 51 53 45 46 49 42 53 53 49
44 44 47 53 54 50 53 51 45 44 60 42 44 60 63 47 63
49 50 47 51 54 54 47 42 44 63 63 59 47 46 58 54 63
63 50 63 63 58 51 60 60 44 63 47 63 63 50 63 43 60
58 63 57 52 52 60 63 58 57 60 60 63 60 58 63 58 58
57 52 52 57 52 52 60 52 58 57 60 60 57 60 35 21 21
21 44 60 60 63 52 52 58 52 52 58 63 63 57 52 46 57
57 57 57 57 63 58 63 60 53 63 58 57 60 60 57 57 63
63 63 63 63 63 60 52 46 58 47 63 63 57 58 60 63 63
63 57 63 63 58 52 52 57 63 57 63 57 63 63 52 57 57
63 43 40 57 60 60 60 57 60 43 43 52 63 60 58 63 57
58 58 52 57 63 57 46 58 63 60 63 63 52 52 63 58 57
63 58 60 50 60 54 50 54 50 49 44 42 44 44 46 46 46
45 47 43 60 49 63 63 54 60 63 58 49 49 49 57 60 60
47 63 54 63 51 50 52 60 50 44 42 44 54 58 58 47 43
49 47 54 63 49 50 60 50 50 43 50 53 39 54 54 54 49
49 43 49 44 50 43 50 49 46 44 43 50 50 49 51 51 43
54 50 49 50 50 50 54 54 42 50 46 54 42 57 43 54 50
42 54 54 59 59 52 34 50 51 50 54 49 50 22 50 54 54
50 35 42 28 39 35 46 54 27 42 35 50 43 49 42 50 35
54 43 16 53 50 27 49 50 31 54 39 42 44 54 35 54 38
18 49 49 38 33 43 49 42 50 33 35 42 18 34 36 39 35
54 43 46 39 54 33 33 43 35 43 49 50 43 30 54 33 50
43 34 54 54 34 42 31 42 16 27 42 34 38 21 54 44 54
50 35 42 54 20 31 54 54 42 30 42 50 27 42 35 43 21
42 35 30 27 35 35 25 30 22 35 32 42 39 16 34 21 29
27 35 32 16 32 32 30 44 22 31 16 13 20 29 21 27 31
29 12 27 25 27 22 32 23 21 22 33 17 16 27 32 24 22
22 28 33 16 27 29 14 44 21 29 17 16 33 44 44 23 24
19 24 31 34 34 12 18 12 35 31 23 17 31 18 22 25 18
12 13 16 34 28 29 38 10 31 19 11 13 18 13 19 31 27
39 28 31 31 27 39 26 13 21 21 18 38 9 26 19 8 7
11 27 28 44 16 27 13 24 12 19 25 44 27 35 19 11 27
29 7 18 12 24 33 21 14 14 14 21 27 15 10 14 14 17
11 17 17 31 44 32 19 32 13 16 15 14 19 14 10 10 30
15 15 17 10 10 12 29 25 46 9 7 8 14 16 12 14 30
14 12 10 13 15 12 13 8 14 12 11 12 14 18 12 14 42
28 25 12 10 9 6 14 34 35 20 11 12 18 13 14 24 16
20 31 11 21 20 10 11 16 13 16 32 14 14 12 12 10 9
11 9 10 7 17 13 11 11 12 9 10 6 8 9 10 6 14
15 14 15 11 10 10 12 15 16 19 16 24 18 12 22 11 19
14 12 9 11 12 15 32 16 15 14 10 9 10 8 12 12 7
10 10 14 14 32 22 27 13 16 12 8