Contig ID Contig-U04690-1
Contig update 2001. 8.29
Contig sequence
>Contig-U04690-1 (Contig-U04690-1Q) /CSM_Contig/Contig-U04690-1Q.Seq.d

Gap no gap
Contig length 577
Chromosome number (1..6, M) 1
Chromosome length 4919822
Start point 810491
End point 811065
Number of clones 1
Number of EST 1
Link to clone list U04690
List of clone(s)

Translated Amino Acid sequence

Translated Amino Acid sequence (All Frames)
Frame A:

Frame B:

Frame C:

own update 2004. 6.10
Homology vs CSM-cDNA
Query= Contig-U04690-1 (Contig-U04690-1Q)
(577 letters)

Database: CSM
6905 sequences; 5,674,871 total letters

Score E
Sequences producing significant alignments: (bits) Value

Contig-U04690-1 (Contig-U04690-1Q) /CSM_Contig/Conti... 856 0.0
Contig-U11332-1 (Contig-U11332-1Q) /CSM_Contig/Conti... 38 0.010
Contig-U11864-1 (Contig-U11864-1Q) /CSM_Contig/Conti... 34 0.16
Contig-U11765-1 (Contig-U11765-1Q) /CSM_Contig/Conti... 34 0.16
Contig-U11288-1 (Contig-U11288-1Q) /CSM_Contig/Conti... 34 0.16
Contig-U10984-1 (Contig-U10984-1Q) /CSM_Contig/Conti... 34 0.16
Contig-U10538-1 (Contig-U10538-1Q) /CSM_Contig/Conti... 34 0.16
Contig-U09531-1 (Contig-U09531-1Q) /CSM_Contig/Conti... 34 0.16
Contig-U12047-1 (Contig-U12047-1Q) /CSM_Contig/Conti... 32 0.63
Contig-U09541-1 (Contig-U09541-1Q) /CSM_Contig/Conti... 32 0.63

>Contig-U04690-1 (Contig-U04690-1Q) /CSM_Contig/Contig-U04690-1Q.Seq.d
Length = 577

Score = 856 bits (432), Expect = 0.0
Identities = 438/438 (100%)
Strand = Plus / Plus

Query: 20 gaatgaacagtcttttaattgatagtagtaacccatcatatgatgcaatgaataatgata 79
Sbjct: 20 gaatgaacagtcttttaattgatagtagtaacccatcatatgatgcaatgaataatgata 79

Query: 80 atttaaagaatagtattgaaaagaatcatccagttaaatcaaaagttttatcaaagaaaa 139
Sbjct: 80 atttaaagaatagtattgaaaagaatcatccagttaaatcaaaagttttatcaaagaaaa 139

Query: 140 ttaataatgttgatacagatattgccatatcatcttttgcagatgcaatctttataacaa 199
Sbjct: 140 ttaataatgttgatacagatattgccatatcatcttttgcagatgcaatctttataacaa 199

Query: 200 tttcacaaaatcaaaaatttaatacatggataagagcaagtaaatcagatggcatattat 259
Sbjct: 200 tttcacaaaatcaaaaatttaatacatggataagagcaagtaaatcagatggcatattat 259

Query: 260 tagatgaaccatcgtatcaaattgatacattattaggtaataatcaagatgtattattta 319
Sbjct: 260 tagatgaaccatcgtatcaaattgatacattattaggtaataatcaagatgtattattta 319

Query: 320 gtatatatgcaattaattgaaaatattggngaaactngtaataaatcattaatgttatca 379
Sbjct: 320 gtatatatgcaattaattgaaaatattggngaaactngtaataaatcattaatgttatca 379

Query: 380 atttctattactgataaatcaaaagatacttttaaacaaattctatcaacaatttttgaa 439
Sbjct: 380 atttctattactgataaatcaaaagatacttttaaacaaattctatcaacaatttttgaa 439

Query: 440 aataaagtatggtaaaat 457
Sbjct: 440 aataaagtatggtaaaat 457

>Contig-U11332-1 (Contig-U11332-1Q) /CSM_Contig/Contig-U11332-1Q.Seq.d
Length = 3658

Score = 38.2 bits (19), Expect = 0.010
Identities = 25/27 (92%)
Strand = Plus / Plus

Query: 395 aaatcaaaagatacttttaaacaaatt 421
||||||||||||||||| | |||||||
Sbjct: 2675 aaatcaaaagatactttaatacaaatt 2701

>Contig-U11864-1 (Contig-U11864-1Q) /CSM_Contig/Contig-U11864-1Q.Seq.d
Length = 1613

Score = 34.2 bits (17), Expect = 0.16
Identities = 17/17 (100%)
Strand = Plus / Minus

Query: 430 aatttttgaaaataaag 446
Sbjct: 1560 aatttttgaaaataaag 1544

Database: CSM
Posted date: Jun 9, 2004 7:35 PM
Number of letters in database: 5,674,871
Number of sequences in database: 6905

Lambda K H
1.37 0.711 1.31

Lambda K H
1.37 0.711 1.31

Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 10,440
Number of Sequences: 6905
Number of extensions: 10440
Number of successful extensions: 1162
Number of sequences better than 10.0: 372
length of query: 577
length of database: 5,674,871
effective HSP length: 16
effective length of query: 561
effective length of database: 5,564,391
effective search space: 3121623351
effective search space used: 3121623351
T: 0
A: 40
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 14 (28.2 bits)
dna update 2009. 6.28
Homology vs DNA
Query= Contig-U04690-1 (Contig-U04690-1Q) /CSM_Contig/Contig-U04690-1Q.Seq.d
(577 letters)

Database: ddbj_A
102,105,510 sequences; 101,790,757,118 total letters


Score E
Sequences producing significant alignments: (bits) Value N

(AU071707) Dictyostelium discoideum slug cDNA, clone SSC319. 438 e-118 1
(C84139) Dictyostelium discoideum slug cDNA, clone SSC319. 202 1e-47 1
(AE017245) Mycoplasma synoviae 53, complete genome. 50 0.094 1
(AC160042) Bos taurus clone CH240-61A3, WORKING DRAFT SEQUEN... 48 0.37 1
(CU657929) Pig DNA sequence *** SEQUENCING IN PROGRESS *** f... 48 0.37 1
(ER413735) 1095390047954 Global-Ocean-Sampling_GS-34-01-01-1... 48 0.37 1
(EK227567) 1095460164063 Global-Ocean-Sampling_GS-31-01-01-1... 48 0.37 1
(EK224206) 1095460153503 Global-Ocean-Sampling_GS-31-01-01-1... 48 0.37 1
(EJ914909) 1093018555185 Global-Ocean-Sampling_GS-30-02-01-1... 48 0.37 1
(EJ885970) 1093018417809 Global-Ocean-Sampling_GS-30-02-01-1... 48 0.37 1
(CT497968) A BAC library has been constructed from cultivar ... 48 0.37 1
(CL412302) RPCI44_430N20.f RPCI-44 Sus scrofa genomic clone ... 48 0.37 1
(AC116920) Dictyostelium discoideum chromosome 2 map 4415041... 32 0.52 7
(AL445563) Mycoplasma pulmonis (strain UAB CTIP) complete ge... 36 0.53 10
(BH679105) BOMCX95TF BO_2_3_KB Brassica oleracea genomic clo... 42 0.56 2
(CT548104) A BAC library has been constructed from cultivar ... 42 0.72 2
(CZ959001) 309873 Tomato EcoRI BAC Library Solanum lycopersi... 40 0.83 2
(EJ874871) 1093018363460 Global-Ocean-Sampling_GS-30-02-01-1... 36 0.86 2
(CP000087) Rickettsia bellii RML369-C, complete genome. 40 1.0 10
(AM285332) Spiroplasma citri GII3-3X chromosome, contig Cont... 36 1.4 4
(AX345857) Sequence 928 from Patent WO0200928. 46 1.5 1
(AL035477) Plasmodium falciparum MAL4P4. 46 1.5 1
(EK078767) 1092961080814 Global-Ocean-Sampling_GS-31-01-01-1... 46 1.5 1
(CP000312) Clostridium perfringens SM101, complete genome. 46 1.5 1
(BA000016) Clostridium perfringens str. 13 DNA, complete gen... 46 1.5 1
(AF063866) Melanoplus sanguinipes entomopoxvirus, complete g... 32 2.0 9
(CV674105) RET7SJ_29G03.T7 Schistosoma japonicum reverse cDN... 40 2.9 2
(AC103853) Homo sapiens chromosome 8, clone RP11-642D21, com... 34 2.9 2
(AC018525) Homo sapiens chromosome 8, clone RP11-3J13, compl... 34 2.9 2
(AY811181) Schistosoma japonicum SJCHGC08744 protein mRNA, p... 40 2.9 2
(AP005354) Homo sapiens genomic DNA, chromosome 8q23, clone:... 34 2.9 2
(CP001184) Ureaplasma urealyticum serovar 10 str. ATCC 33699... 32 3.5 12
(AE017263) Mesoplasma florum L1 complete genome. 34 3.6 11
(EK416985) 1095515470905 Global-Ocean-Sampling_GS-31-01-01-1... 34 3.8 2
(EK407857) 1095505093091 Global-Ocean-Sampling_GS-31-01-01-1... 34 3.8 2
(CS374494) Sequence 597 from Patent WO2006034879. 40 4.8 2
(CR545469) Zebrafish DNA sequence from clone DKEY-151K14 in ... 44 5.8 1
(AC123599) Mus musculus chromosome 5, clone RP23-231D13, com... 44 5.8 1
(AC146437) Pan troglodytes BAC clone RP43-15J3 from chromoso... 44 5.8 1
(AP009720) Lotus japonicus genomic DNA, chromosome 2, clone:... 44 5.8 1
(AP006685) Lotus japonicus genomic DNA, chromosome 1, clone:... 44 5.8 1
(GC611706) Sequence 15156 from patent US 7432049. 44 5.8 1
(CQ670230) Sequence 15156 from Patent WO02070737. 44 5.8 1
(AC004028) Homo sapiens PAC clone RP4-800B9 from 7, complete... 44 5.8 1
(AC153098) Carollia perspicillata clone 432B2, WORKING DRAFT... 44 5.8 1
(AC152359) Carollia perspicillata clone 57F10, WORKING DRAFT... 44 5.8 1
(AC105837) Rattus norvegicus clone CH230-44I4, *** SEQUENCIN... 44 5.8 1
(AC068632) Homo sapiens chromosome 3 clone RP11-804O8, *** S... 44 5.8 1
(CU467785) Pig DNA sequence *** SEQUENCING IN PROGRESS *** f... 44 5.8 1
(AC232824) Lama pacos clone CH246-360M16, WORKING DRAFT SEQU... 44 5.8 1
(AC232721) Lama pacos clone CH246-275J9, WORKING DRAFT SEQUE... 44 5.8 1
(AC232176) Lama pacos clone CH246-300C13, WORKING DRAFT SEQU... 44 5.8 1
(AC221248) Bos taurus clone CH240-400N2, WORKING DRAFT SEQUE... 44 5.8 1
(AC221242) Bos taurus clone CH240-400I9, WORKING DRAFT SEQUE... 44 5.8 1
(AC202219) Acyrthosiphon pisum clone VMRC38-20-A4, WORKING D... 44 5.8 1
(AC185185) Felis catus clone RP86-429L13, WORKING DRAFT SEQU... 44 5.8 1
(AC167058) Bos taurus clone CH240-189P19, WORKING DRAFT SEQU... 44 5.8 1
(ER326438) 1092344215254 Global-Ocean-Sampling_GS-34-01-01-1... 44 5.8 1
(EK415886) 1095515462687 Global-Ocean-Sampling_GS-31-01-01-1... 44 5.8 1
(EK304612) 1095462376296 Global-Ocean-Sampling_GS-31-01-01-1... 44 5.8 1
(EK279915) 1095462291407 Global-Ocean-Sampling_GS-31-01-01-1... 44 5.8 1
(EK268468) 1095462243023 Global-Ocean-Sampling_GS-31-01-01-1... 44 5.8 1
(EK242332) 1095460237785 Global-Ocean-Sampling_GS-31-01-01-1... 44 5.8 1
(CL486513) SAIL_436_C05.v1 SAIL Collection Arabidopsis thali... 44 5.8 1
(ES394609) MUS05-N06.x1d-t SHGC-MUS Mytilus californianus cD... 44 5.8 1
(ES394373) MUS05-N06.y1d-s SHGC-MUS Mytilus californianus cD... 44 5.8 1
(AV690467) Homo sapiens cDNA clone:GKCGWA12, 5'end, expresse... 44 5.8 1
(AC116960) Dictyostelium discoideum chromosome 2 map complem... 34 5.9 6
(CP000770) Candidatus Sulcia muelleri GWSS, complete genome. 38 6.0 6
(BA000026) Mycoplasma penetrans HF-2 DNA, complete genome. 32 6.0 16
(AC117176) Dictyostelium discoideum chromosome 2 map 5018074... 32 6.2 7
(AL929351) Plasmodium falciparum strain 3D7, chromosome 5, s... 38 7.4 6
(AC005323) Homo sapiens chromosome 17, clone hRPK.799_N_11, ... 40 7.6 4
(AX347076) Sequence 2147 from Patent WO0200928. 36 8.6 6
(CP000768) Campylobacter jejuni subsp. doylei 269.97, comple... 30 8.8 2
(EX163234) LY_YIT_DP1310 Dermatophagoides pteronyssinus cDNA... 36 8.9 2
(AP006852) Candida albicans genomic DNA, chromosome 7, compl... 32 9.3 2
(GE799624) EST_scau_evk_888927 scauevk mixed_tissue Sebastes... 34 9.9 2

>(AU071707) Dictyostelium discoideum slug cDNA, clone SSC319.
Length = 240

Score = 438 bits (221), Expect = e-118
Identities = 221/221 (100%)
Strand = Plus / Plus

Query: 20 gaatgaacagtcttttaattgatagtagtaacccatcatatgatgcaatgaataatgata 79
Sbjct: 20 gaatgaacagtcttttaattgatagtagtaacccatcatatgatgcaatgaataatgata 79

Query: 80 atttaaagaatagtattgaaaagaatcatccagttaaatcaaaagttttatcaaagaaaa 139
Sbjct: 80 atttaaagaatagtattgaaaagaatcatccagttaaatcaaaagttttatcaaagaaaa 139

Query: 140 ttaataatgttgatacagatattgccatatcatcttttgcagatgcaatctttataacaa 199
Sbjct: 140 ttaataatgttgatacagatattgccatatcatcttttgcagatgcaatctttataacaa 199

Query: 200 tttcacaaaatcaaaaatttaatacatggataagagcaagt 240
Sbjct: 200 tttcacaaaatcaaaaatttaatacatggataagagcaagt 240

Lambda K H
1.37 0.711 1.31

Matrix: blastn matrix:1 -3
Number of Sequences: 102105510
Number of Hits to DB: 604,935,990
Number of extensions: 37835779
Number of successful extensions: 3281342
Number of sequences better than 10.0: 79
Length of query: 577
Length of database: 101,790,757,118
Length adjustment: 23
Effective length of query: 554
Effective length of database: 99,442,330,388
Effective search space: 55091051034952
Effective search space used: 55091051034952
X1: 11 (21.8 bits)
S2: 22 (44.1 bits)

protein update 2009. 7.30
Homology vs Protein
Query= Contig-U04690-1 (Contig-U04690-1Q) /CSM_Contig/Contig-U04690-1Q.Seq.d
(577 letters)

Database: nrp_A
3,268,448 sequences; 1,061,185,681 total letters


Score E
Sequences producing significant alignments: (bits) Value

AC092388_5(AC092388|pid:none) Oryza sativa chromosome 10 BAC OSJ... 42 0.016
AK242314_1(AK242314|pid:none) Oryza sativa Japonica Group cDNA, ... 42 0.016
AY586358_1(AY586358|pid:none) Castanea crenata NADH dehydrogenas... 34 2.5
AY586360_1(AY586360|pid:none) Quercus falcata NADH dehydrogenase... 34 2.5
FJ185077_1(FJ185077|pid:none) Chrysolepis chrysophylla voucher F... 34 2.5
FJ185081_1(FJ185081|pid:none) Lithocarpus densiflorus voucher 92... 34 2.5
FJ185083_1(FJ185083|pid:none) Lithocarpus xylocarpus voucher 146... 34 2.5
DQ366715_33(DQ366715|pid:none) Uncultured Prochlorococcus marinu... 33 4.2
(Q8IDG7) RecName: Full=Uncharacterized protein PF13_0277; &AL84... 33 5.5
DQ851549_1(DQ851549|pid:none) Rhamnus cathartica NADH dehydrogen... 32 9.5
T13667(T13667) NADH2 dehydrogenase (ubiquinone) (EC cha... 32 9.5

>AC092388_5(AC092388|pid:none) Oryza sativa chromosome 10 BAC
OSJNBa0011L09 genomic sequence, complete sequence.
Length = 147

Score = 41.6 bits (96), Expect = 0.016
Identities = 21/42 (50%), Positives = 30/42 (71%), Gaps = 1/42 (2%)
Frame = +2


Lambda K H
0.318 0.134 0.401

Lambda K H
0.267 0.0410 0.140

Matrix: BLOSUM62
Gap Penalties: Existence: 11, Extension: 1
Number of Sequences: 3268448
Number of Hits to DB: 568,682,111
Number of extensions: 7902687
Number of successful extensions: 19788
Number of sequences better than 10.0: 11
Number of HSP's gapped: 19753
Number of HSP's successfully gapped: 11
Length of query: 192
Length of database: 1,061,185,681
Length adjustment: 122
Effective length of query: 70
Effective length of database: 662,435,025
Effective search space: 46370451750
Effective search space used: 46370451750
Neighboring words threshold: 12
Window for multiple hits: 40
X1: 16 ( 7.3 bits)
X2: 38 (14.6 bits)
X3: 64 (24.7 bits)
S1: 41 (21.7 bits)
S2: 30 (16.2 bits)


psg: 0.64 gvh: 0.40 alm: 0.39 top: 0.53 tms: 0.00 mit: 0.26 mip: 0.02
nuc: 0.00 erl: 0.00 erm: 0.20 pox: 0.00 px2: 0.00 vac: 0.00 rnp: 0.00
act: 0.00 caa: 0.00 yqr: 0.00 tyr: 0.00 leu: 0.00 gpi: 0.00 myr: 0.00
dna: 0.00 rib: 0.00 bac: 0.00 m1a: 0.00 m1b: 0.00 m2 : 0.00 mNt: 0.00
m3a: 0.00 m3b: 0.00 m_ : 1.00

52.0 %: cytoplasmic
32.0 %: nuclear
8.0 %: mitochondrial
4.0 %: vacuolar
4.0 %: peroxisomal

>> prediction for Contig-U04690-1 is cyt

VS (DIR, S) 0
VH (FL, L) 0
VF (FL, S) 0
AH (FL, L) 0
AF (FL, S) 0
SL (DIR, L) 0
SS (DIR, S) 1
SH (FL, L) 0
SF (FL, S) 0
CH (FL, L) 0
CF (FL, S) 0
FCL (DIR, L) 0
FC (DIR, S) 0