NBDC - アーカイブトップ - ヘルプ
データベースの説明 | データ項目の説明 | 利用許諾 | ヘルプ
Dicty_cDB
Contig List | Clone List | cDNA Library List
Atlas
Atlas | Atlas Image List
NBDC - LSDB Archive
Description of this DB | Description of data items | Download | License
Dicty_cDB
Contig List | Clone List | cDNA Library List
Atlas
Atlas | Atlas Image List
Contig-U13556-1
Contig ID Contig-U13556-1
Contig update 2002.12.18
Contig sequence 
>Contig-U13556-1 (Contig-U13556-1Q) /CSM_Contig/Contig-U13556-1Q.Seq.d
CAAAAAAAATTAATGCAATCATTCAACCAGTCATAAAACAAACTAATATT
AAAAACCAATATAGTTCTTTTTTTTTTTCGNCATATTAAATNGTTNCCNT
TAAAAATAAAAAATAAAAAAAAATAANTAANTAAAATCANCNTCAANTNG
TAAAAAAAAAANNNNNNNNN
Gap no gap
Contig length 170
Chromosome number (1..6, M) 3
Chromosome length 6358359
Start point 1454842
End point 1454681
Strand (PLUS/MINUS) MINUS
Number of clones 1
Number of EST 1
Link to clone list U13556
List of clone(s) 

est1=VHB696F,1,161
Translated Amino Acid sequence 
qkklmqsfnqs*NKLILKTNIVLFFFRHIKXXPLKIKNKKK*xxkixxxx*kkxxx
Translated Amino Acid sequence (All Frames) 
Frame A:
qkklmqsfnqs*NKLILKTNIVLFFFRHIKXXPLKIKNKKK*xxkixxxx*kkxxx


Frame B:
kkn*cnhstshktn*y*kpi*fffffxilnxxx*k*kikknx*xksxsxxkkkxxx


Frame C:
kkinaiiqpvikqtniknqyssfffsxy*xvxxknkk*kkixx*nxxqxvkkkxxx
own update 2004. 6.10
Homology vs CSM-cDNA 
Query= Contig-U13556-1 (Contig-U13556-1Q)
/CSM_Contig/Contig-U13556-1Q.Seq.d
         (170 letters)

Database: CSM
           6905 sequences; 5,674,871 total letters


                                                                   Score     E
Sequences producing significant alignments:                        (bits)  Value

Contig-U13556-1 (Contig-U13556-1Q) /CSM_Contig/Conti...   115  2e-26
Contig-U09398-1 (Contig-U09398-1Q) /CSM_Contig/Conti...    32  0.17
Contig-U14690-1 (Contig-U14690-1Q) /CSM_Contig/Conti...    30  0.69
Contig-U11573-1 (Contig-U11573-1Q) /CSM_Contig/Conti...    30  0.69
Contig-U04354-1 (Contig-U04354-1Q) /CSM_Contig/Conti...    30  0.69
Contig-U12908-1 (Contig-U12908-1Q) /CSM_Contig/Conti...    28  2.7
Contig-U11300-1 (Contig-U11300-1Q) /CSM_Contig/Conti...    28  2.7
Contig-U09810-1 (Contig-U09810-1Q) /CSM_Contig/Conti...    28  2.7
Contig-U05702-1 (Contig-U05702-1Q) /CSM_Contig/Conti...    28  2.7

>Contig-U13556-1 (Contig-U13556-1Q) /CSM_Contig/Contig-U13556-1Q.Seq.d
          Length = 170

 Score =  115 bits (58), Expect = 2e-26
 Identities = 58/58 (100%)
 Strand = Plus / Plus

                                                                    
Query: 10 ttaatgcaatcattcaaccagtcataaaacaaactaatattaaaaaccaatatagttc 67
          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 10 ttaatgcaatcattcaaccagtcataaaacaaactaatattaaaaaccaatatagttc 67


>Contig-U09398-1 (Contig-U09398-1Q) /CSM_Contig/Contig-U09398-1Q.Seq.d
          Length = 1222

 Score = 32.2 bits (16), Expect = 0.17
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                            
Query: 40   aaactaatattaaaaa 55
            ||||||||||||||||
Sbjct: 1166 aaactaatattaaaaa 1151


>Contig-U14690-1 (Contig-U14690-1Q) /CSM_Contig/Contig-U14690-1Q.Seq.d
          Length = 1088

 Score = 30.2 bits (15), Expect = 0.69
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                          
Query: 34  taaaacaaactaata 48
           |||||||||||||||
Sbjct: 468 taaaacaaactaata 482


  Database: CSM
    Posted date:  Jun 9, 2004  7:35 PM
  Number of letters in database: 5,674,871
  Number of sequences in database:  6905
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 992
Number of Sequences: 6905
Number of extensions: 992
Number of successful extensions: 310
Number of sequences better than 10.0: 11
length of query: 170
length of database: 5,674,871
effective HSP length: 15
effective length of query: 155
effective length of database: 5,571,296
effective search space: 863550880
effective search space used: 863550880
T: 0
A: 40
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 14 (28.2 bits)
dna update 2008.12.11
Homology vs DNA 
Query= Contig-U13556-1 (Contig-U13556-1Q) /CSM_Contig/Contig-U13556-1Q.Seq.d
         (170 letters)

Database: ddbj_A
           92,845,959 sequences; 95,242,211,685 total letters

Searching..................................................done

                                                             Score    E
Sequences producing significant alignments:                  (bits) Value  N

(BJ419074) Dictyostelium discoideum cDNA clone:ddv34o24, 5' ...   115   5e-22  1
(BD453086) Diagnosis of Diseases Associated with tumor suppr...    38   1.4    3
(AX347328) Sequence 2399 from Patent WO0200928.                    38   1.4    3
(AX251565) Sequence 533 from Patent WO0168912.                     38   1.4    3
(EJ488117) 1095403517097 Global-Ocean-Sampling_GS-28-01-01-1...    44   1.5    1
(CJ342713) Molgula tectiformis cDNA, embryo just before hatc...    44   1.5    1
(CJ332738) Molgula tectiformis cDNA, embryo just before hatc...    44   1.5    1
(AC097729) Rattus norvegicus clone CH230-4I14, WORKING DRAFT...    42   2.5    2
(AC126725) Rattus norvegicus clone CH230-6I18, *** SEQUENCIN...    42   2.6    2
(CU302192) Zebrafish DNA sequence from clone DKEY-189E16 in ...    42   5.8    1
(CT027637) Zebrafish DNA sequence from clone DKEY-78B4 in li...    42   5.8    1
(AX346844) Sequence 1915 from Patent WO0200928.                    42   5.8    1
(AX346552) Sequence 1623 from Patent WO0200928.                    42   5.8    1
(AX323721) Sequence 209 from Patent WO0192565.                     42   5.8    1
(AY353829) Nirridessus sweetwatersensis 16S ribosomal RNA ge...    42   5.8    1
(AC117852) Rattus norvegicus clone CH230-149B22, *** SEQUENC...    42   5.8    1
(CU856118) Pig DNA sequence *** SEQUENCING IN PROGRESS *** f...    42   5.8    1
(AC202743) Equus caballus clone CH241-389N10, WORKING DRAFT ...    42   5.8    1
(AC189472) Brassica rapa subsp. pekinensis clone KBrB080E18,...    42   5.8    1
(FH046697) CHO_OF3310xa22r1.ab1 CHO_OF3 Nicotiana tabacum ge...    42   5.8    1
(EJ984214) 1093022175386 Global-Ocean-Sampling_GS-30-02-01-1...    42   5.8    1
(EJ861180) 1093017979587 Global-Ocean-Sampling_GS-30-02-01-1...    42   5.8    1
(BZ145423) CH230-368G13.TV CHORI-230 Segment 2 Rattus norveg...    42   5.8    1
(BA000028) Oceanobacillus iheyensis HTE831 DNA, complete gen...    42   5.8    1
(AA549914) 0987m3 gmbPfHB3.1, G. Roman Reddy Plasmodium falc...    38   6.5    2
(AU088030) Plasmodium falciparum 3D7 cDNA clone from Sugano ...    38   6.8    2
(AU086132) Plasmodium falciparum 3D7 cDNA clone from Sugano ...    38   6.8    2
(AE017199) Nanoarchaeum equitans Kin4-M, complete genome.          38   8.4    3

>(BJ419074) Dictyostelium discoideum cDNA clone:ddv34o24, 5' end,
          single read.
          Length = 161

 Score =  115 bits (58), Expect = 5e-22
 Identities = 58/58 (100%)
 Strand = Plus / Plus


Query: 10 ttaatgcaatcattcaaccagtcataaaacaaactaatattaaaaaccaatatagttc 67
          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 10 ttaatgcaatcattcaaccagtcataaaacaaactaatattaaaaaccaatatagttc 67

Lambda     K      H
    1.37    0.711     1.31

Matrix: blastn matrix:1 -3
Number of Sequences: 92845959
Number of Hits to DB: 84,238,952
Number of extensions: 4981415
Number of successful extensions: 1314251
Number of sequences better than 10.0: 29
Length of query: 170
Length of database: 95,242,211,685
Length adjustment: 22
Effective length of query: 148
Effective length of database: 93,199,600,587
Effective search space: 13793540886876
Effective search space used: 13793540886876
X1: 11 (21.8 bits)
S2: 21 (42.1 bits)
protein update 2009. 7. 7
Homology vs Protein 
Query= Contig-U13556-1 (Contig-U13556-1Q) /CSM_Contig/Contig-U13556-1Q.Seq.d
         (170 letters)

Database: nrp_B
           3,236,559 sequences; 1,051,180,864 total letters

Searching..................................................done

 ***** No hits found ******

Lambda     K      H
   0.318    0.134    0.401

Gapped
Lambda     K      H
   0.267   0.0410    0.140

Matrix: BLOSUM62
Gap Penalties: Existence: 11, Extension: 1
Number of Sequences: 3236559
Number of Hits to DB: 130,372,783
Number of extensions: 2686204
Number of successful extensions: 1825
Number of sequences better than 10.0: 0
Number of HSP's gapped: 1825
Number of HSP's successfully gapped: 0
Length of query: 56
Length of database: 1,051,180,864
Length adjustment: 29
Effective length of query: 27
Effective length of database: 957,320,653
Effective search space: 25847657631
Effective search space used: 25847657631
Neighboring words threshold: 12
Window for multiple hits: 40
X1: 16 ( 7.3 bits)
X2: 38 (14.6 bits)
X3: 64 (24.7 bits)
S1: 41 (21.7 bits)
S2: 26 (14.6 bits)
PSORT 

 psg: 0.92  gvh: 0.43  alm: 0.44  top: 0.83  tms: 0.00  mit: 0.46  mip: 0.00
 nuc: 0.24  erl: 0.00  erm: 0.60  pox: 0.00  px2: 0.00  vac: 0.00  rnp: 0.00
 act: 0.00  caa: 0.00  yqr: 0.00  tyr: 0.00  leu: 0.00  gpi: 0.00  myr: 0.00
 dna: 0.00  rib: 0.00  bac: 0.00  m1a: 0.00  m1b: 0.00  m2 : 0.00  mNt: 0.00
 m3a: 0.00  m3b: 0.00  m_ : 1.00 

	 52.0 %: nuclear
	 28.0 %: mitochondrial
	 20.0 %: cytoplasmic

>> prediction for Contig-U13556-1 is nuc
VS (DIR, S) 0
VH (FL, L) 1
VF (FL, S) 0
AH (FL, L) 0
AF (FL, S) 0
SL (DIR, L) 0
SS (DIR, S) 0
SH (FL, L) 0
SF (FL, S) 0
CH (FL, L) 0
CF (FL, S) 0
FCL (DIR, L) 0
FC (DIR, S) 0
FC-IC (SUB) 0