Contig-U03161-1
Contig ID Contig-U03161-1
Contig update 2001. 8.29
Contig sequence
>Contig-U03161-1 (Contig-U03161-1Q) /CSM_Contig/Contig-U03161-1Q.Seq.d
TAATTTCATATAAAAGGTTCATTGNAAAAGAAGTTTTAATTAAAAATATT
AAATATTCAACCTATGTTAGAGATAATAATGGAAAGATTGATTTATCAAT
TTCNGAATAGAAAATTGGAAATGCNAATACTGGAAAATTGAAACTTCAAT
TGTTAGTAACAAAAATAATAA

Gap no gap
Contig length 171
Chromosome number (1..6, M) 6
Chromosome length 3595308
Start point 486506
End point 486677
Strand (PLUS/MINUS) PLUS
Number of clones 1
Number of EST 1
Link to clone list U03161
List of clone(s)

est1=CFD469Z,1,172
Translated Amino Acid sequence
ISYKRFIXKEVLIKNIKYSTYVRDNNGKIDLSISE*kignantgklklqllvtkii


Translated Amino Acid sequence (All Frames)
Frame A:
*fhikgslxkkf*lkilniqpmleiimerliyqfxnrklemxilen*nfnc**qk**


Frame B:
nfi*kvhxkrsfn*ky*ifnlc*r**wkd*finfxienwkcxywkietsivsnknn


Frame C:
ISYKRFIXKEVLIKNIKYSTYVRDNNGKIDLSISE*kignantgklklqllvtkii


own update 2004. 6. 9
Homology vs CSM-cDNA
Query= Contig-U03161-1 (Contig-U03161-1Q)
/CSM_Contig/Contig-U03161-1Q.Seq.d
(171 letters)

Database: CSM
6905 sequences; 5,674,871 total letters


Score E
Sequences producing significant alignments: (bits) Value

Contig-U03161-1 (Contig-U03161-1Q) /CSM_Contig/Conti... 321 1e-88
Contig-U01724-1 (Contig-U01724-1Q) /CSM_Contig/Conti... 40 7e-04
Contig-U13888-1 (Contig-U13888-1Q) /CSM_Contig/Conti... 36 0.011
Contig-U13008-1 (Contig-U13008-1Q) /CSM_Contig/Conti... 34 0.044
Contig-U11650-1 (Contig-U11650-1Q) /CSM_Contig/Conti... 34 0.044
Contig-U09466-1 (Contig-U09466-1Q) /CSM_Contig/Conti... 34 0.044
Contig-U14527-1 (Contig-U14527-1Q) /CSM_Contig/Conti... 32 0.17
Contig-U14090-1 (Contig-U14090-1Q) /CSM_Contig/Conti... 32 0.17
Contig-U13724-1 (Contig-U13724-1Q) /CSM_Contig/Conti... 32 0.17
Contig-U13546-1 (Contig-U13546-1Q) /CSM_Contig/Conti... 32 0.17

>Contig-U03161-1 (Contig-U03161-1Q) /CSM_Contig/Contig-U03161-1Q.Seq.d
Length = 171

Score = 321 bits (162), Expect = 1e-88
Identities = 171/171 (100%)
Strand = Plus / Plus


Query: 1 taatttcatataaaaggttcattgnaaaagaagttttaattaaaaatattaaatattcaa 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1 taatttcatataaaaggttcattgnaaaagaagttttaattaaaaatattaaatattcaa 60


Query: 61 cctatgttagagataataatggaaagattgatttatcaatttcngaatagaaaattggaa 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61 cctatgttagagataataatggaaagattgatttatcaatttcngaatagaaaattggaa 120


Query: 121 atgcnaatactggaaaattgaaacttcaattgttagtaacaaaaataataa 171
|||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121 atgcnaatactggaaaattgaaacttcaattgttagtaacaaaaataataa 171


>Contig-U01724-1 (Contig-U01724-1Q) /CSM_Contig/Contig-U01724-1Q.Seq.d
Length = 971

Score = 40.1 bits (20), Expect = 7e-04
Identities = 20/20 (100%)
Strand = Plus / Plus


Query: 36 ttaattaaaaatattaaata 55
||||||||||||||||||||
Sbjct: 841 ttaattaaaaatattaaata 860


>Contig-U13888-1 (Contig-U13888-1Q) /CSM_Contig/Contig-U13888-1Q.Seq.d
Length = 1443

Score = 36.2 bits (18), Expect = 0.011
Identities = 18/18 (100%)
Strand = Plus / Plus


Query: 38 aattaaaaatattaaata 55
||||||||||||||||||
Sbjct: 84 aattaaaaatattaaata 101


Database: CSM
Posted date: Jun 9, 2004 7:35 PM
Number of letters in database: 5,674,871
Number of sequences in database: 6905

Lambda K H
1.37 0.711 1.31

Gapped
Lambda K H
1.37 0.711 1.31


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5863
Number of Sequences: 6905
Number of extensions: 5863
Number of successful extensions: 1629
Number of sequences better than 10.0: 229
length of query: 171
length of database: 5,674,871
effective HSP length: 15
effective length of query: 156
effective length of database: 5,571,296
effective search space: 869122176
effective search space used: 869122176
T: 0
A: 40
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 14 (28.2 bits)
dna update 2009. 5.26
Homology vs DNA
Query= Contig-U03161-1 (Contig-U03161-1Q) /CSM_Contig/Contig-U03161-1Q.Seq.d
(171 letters)

Database: ddbj_A
102,105,510 sequences; 101,790,757,118 total letters

Searching..................................................done

Score E
Sequences producing significant alignments: (bits) Value N

(BJ374398) Dictyostelium discoideum cDNA clone:ddc7j18, 3' e... 321 4e-84 1
(AM460485) Vitis vinifera contig VV78X212413.3, whole genome... 36 0.052 4
(AM483770) Vitis vinifera contig VV78X208093.11, whole genom... 48 0.10 1
(AM473042) Vitis vinifera, whole genome shotgun sequence, co... 48 0.10 1
(AM471676) Vitis vinifera contig VV78X014908.4, whole genome... 48 0.10 1
(AM470981) Vitis vinifera contig VV78X118221.7, whole genome... 48 0.10 1
(AM470966) Vitis vinifera contig VV78X156697.1, whole genome... 48 0.10 1
(AM463885) Vitis vinifera contig VV78X143191.5, whole genome... 48 0.10 1
(AM460273) Vitis vinifera contig VV78X207888.4, whole genome... 48 0.10 1
(AM454411) Vitis vinifera contig VV78X015370.3, whole genome... 48 0.10 1
(AM449685) Vitis vinifera contig VV78X198054.5, whole genome... 48 0.10 1
(AM441032) Vitis vinifera contig VV78X220848.4, whole genome... 48 0.10 1
(AM432741) Vitis vinifera contig VV78X010130.1, whole genome... 48 0.10 1
(AM428287) Vitis vinifera contig VV78X122625.4, whole genome... 48 0.10 1
(AM426697) Vitis vinifera contig VV78X157641.7, whole genome... 48 0.10 1
(AL391748) Human chromosome 14 DNA sequence BAC R-630G18 of ... 48 0.10 1
(AM488888) Vitis vinifera contig VV78X260670.4, whole genome... 38 0.16 3
(CU928731) Pig DNA sequence *** SEQUENCING IN PROGRESS *** f... 40 0.16 2
(AM457844) Vitis vinifera, whole genome shotgun sequence, co... 40 0.18 4
(BV556607) S222P61431FG3.T0 Karlien Pan troglodytes verus ST... 36 0.21 2
(BV538693) G591P635903FA8.T0 Clint Pan troglodytes verus STS... 36 0.21 2
(AC129004) Rattus norvegicus clone CH230-6A16, WORKING DRAFT... 34 0.23 2
(EJ165649) 1092344064438 Global-Ocean-Sampling_GS-27-01-01-1... 44 0.27 2
(AC231820) Oryza minuta clone OM__Ba0060G10, complete sequence. 46 0.28 3
(AC079434) Mus musculus chromosome 16 clone RP23-95I8, WORKI... 34 0.29 5
(AM462665) Vitis vinifera contig VV78X135192.8, whole genome... 46 0.36 2
(AC192131) Pan troglodytes BAC clone CH251-604B11 from chrom... 46 0.40 1
(AM474639) Vitis vinifera contig VV78X275359.1, whole genome... 46 0.40 1
(AM452248) Vitis vinifera, whole genome shotgun sequence, co... 46 0.40 1
(AM444581) Vitis vinifera, whole genome shotgun sequence, co... 46 0.40 1
(AE013599) Drosophila melanogaster chromosome 2R, complete s... 46 0.40 1
(AL691447) Human DNA sequence from clone RP11-307E17 on chro... 46 0.40 1
(AL669815) Human DNA sequence from clone RP11-565E9 on chrom... 46 0.40 1
(AL359212) Human chromosome 14 DNA sequence BAC R-10A2 of li... 46 0.40 1
(AL161415) Human chromosome 14 DNA sequence BAC R-139D16 of ... 46 0.40 1
(AC068960) Homo sapiens chromosome 8 clone CTD-2026M16 map 8... 46 0.40 1
(AC231824) Oryza minuta clone OM__Ba0029A23, *** SEQUENCING ... 46 0.40 1
(AC016481) Homo sapiens clone RP11-30H11, WORKING DRAFT SEQU... 46 0.40 1
(EJ144027) 1092343677578 Global-Ocean-Sampling_GS-27-01-01-1... 46 0.40 1
(AC108805) Mus musculus chromosome 9, clone RP23-226G13, com... 34 0.41 5
(U53150) Caenorhabditis elegans cosmid F20A1, complete seque... 38 0.42 3
(AM469346) Vitis vinifera contig VV78X164033.2, whole genome... 42 0.44 2
(AM466400) Vitis vinifera, whole genome shotgun sequence, co... 40 0.50 5
(AC213944) Equus caballus clone CH241-420A7, WORKING DRAFT S... 40 0.54 3
(DV353071) NABX228TF Aedes aegypti infected with Plasmodium ... 40 0.67 2
(CP000728) Clostridium botulinum F str. Langeland, complete ... 34 0.69 2
(AM412317) Clostridium botulinum A str. ATCC 3502 complete g... 34 0.69 2
(CP000726) Clostridium botulinum A str. ATCC 19397, complete... 34 0.69 2
(CP000727) Clostridium botulinum A str. Hall, complete genome. 34 0.69 2
(DV353072) NABX228TO Aedes aegypti infected with Plasmodium ... 40 0.71 2
(DV236301) A2FL989TO Aedes aegypti full length cDNA library,... 40 0.72 2
(DV368255) NACBN85TF Aedes aegypti infected with Brugia Mala... 40 0.75 2
(DV343174) NABWQ94TF Aedes aegypti infected with Brugia Mala... 40 0.76 2
(DV404437) NADVR25TF Aedes aegypti infected with Dengue viru... 40 0.79 2
(EJ541835) 1092955383938 Global-Ocean-Sampling_GS-29-01-01-1... 38 0.80 2
(DV236303) A2FL989TV Aedes aegypti full length cDNA library,... 40 0.81 2
(DV305582) NABN955TF Aedes aegypti infected with Brugia Mala... 40 0.81 2
(DV239474) A2FLL74TO Aedes aegypti full length cDNA library,... 40 0.83 2
(DV316000) NABOG66TF Aedes aegypti infected with Brugia Mala... 40 0.86 2
(DV315941) NABOG53T1O Aedes aegypti infected with Brugia Mal... 40 0.91 2
(EJ565190) 1092959705550 Global-Ocean-Sampling_GS-29-01-01-1... 38 0.98 2
(AC232509) Brassica rapa subsp. pekinensis clone KBrB061C02,... 40 1.1 4
(ED701046) GM_WBb0043J12.r GM_WBb Glycine max genomic clone ... 32 1.1 2
(CF370786) rg53h06.y1 Meloidogyne hapla female SMART pGEM Me... 34 1.1 2
(CS468879) Sequence 70 from Patent EP1748080. 42 1.2 2
(CS419356) Sequence 70 from Patent WO2006094836. 42 1.2 2
(AC146790) Medicago truncatula clone mth2-123b21, complete s... 34 1.3 6
(AM475403) Vitis vinifera contig VV78X059505.5, whole genome... 36 1.4 4
(AC201085) Strongylocentrotus purpuratus clone R3-13E6, WORK... 44 1.4 3
(AC144772) Mus musculus BAC clone RP24-173G12 from chromosom... 40 1.4 3
(CT737197) Zebrafish DNA sequence from clone DKEYP-94F8 in l... 44 1.6 1
(CR450744) Zebrafish DNA sequence from clone CH211-242F18 in... 44 1.6 1
(CR352290) Zebrafish DNA sequence from clone DKEY-107G12 in ... 44 1.6 1
(BX530083) Zebrafish DNA sequence from clone DKEY-3L17 in li... 44 1.6 1
(BX293994) Zebrafish DNA sequence from clone DKEY-256K14 in ... 44 1.6 1
(AL807777) Mouse DNA sequence from clone RP23-392C8 on chrom... 44 1.6 1
(AL645968) Mouse DNA sequence from clone DN-25M4 on chromoso... 44 1.6 1
(AL627074) Mouse DNA sequence from clone RP23-465A17 on chro... 44 1.6 1
(AC116183) Rattus norvegicus 2 BAC CH230-24G20 (Children's H... 44 1.6 1
(AY530096) Glycine max isoflavone synthase 1 gene, promoter ... 44 1.6 1
(AM455312) Vitis vinifera contig VV78X045408.8, whole genome... 44 1.6 1
(EA108453) Sequence 17 from patent US 7196247. 44 1.6 1
(EA108450) Sequence 14 from patent US 7196247. 44 1.6 1
(EA108442) Sequence 6 from patent US 7196247. 44 1.6 1
(AF190022) Molops edurus 12S ribosomal RNA gene, partial seq... 44 1.6 1
(AC133680) Homo sapiens 3 BAC RP11-102C20 (Roswell Park Canc... 44 1.6 1
(AC026673) Homo sapiens 3 BAC RP11-56B20 (Roswell Park Cance... 44 1.6 1
(AC022196) Homo sapiens, clone RP11-27M9, complete sequence. 44 1.6 1
(CU463970) Pig DNA sequence *** SEQUENCING IN PROGRESS *** f... 44 1.6 1
(CR628401) Zebrafish DNA sequence *** SEQUENCING IN PROGRESS... 44 1.6 1
(AC216423) Solanum lycopersicum chromosome 7 clone C07HBa016... 44 1.6 1
(AC214972) Nomascus leucogenys chromosome UNK clone CH271-67... 44 1.6 1
(AC182648) Solanum lycopersicum chromosome 5 clone C05HBa023... 44 1.6 1
(AC170612) Bos taurus clone CH240-246H14, WORKING DRAFT SEQU... 44 1.6 1
(BH147906) ENTPO21TF Entamoeba histolytica Sheared DNA Entam... 44 1.6 1
(AZ692965) ENTKX36TF Entamoeba histolytica Sheared DNA Entam... 44 1.6 1
(AZ689887) ENTLP46TR Entamoeba histolytica Sheared DNA Entam... 44 1.6 1
(AZ689878) ENTLP46TF Entamoeba histolytica Sheared DNA Entam... 44 1.6 1
(AZ549028) ENTDV37TF Entamoeba histolytica Sheared DNA Entam... 44 1.6 1
(ER877486) MUGQ_CH252P267O21T7_CN552_081 CHORI-252 Vervet Mo... 44 1.6 1
(EK586983) 1095522116880 Global-Ocean-Sampling_GS-32-01-01-1... 44 1.6 1
(EK179204) 1095458112654 Global-Ocean-Sampling_GS-31-01-01-1... 44 1.6 1
(EK150441) 1095456048711 Global-Ocean-Sampling_GS-31-01-01-1... 44 1.6 1
(EJ786362) 1093017318355 Global-Ocean-Sampling_GS-30-02-01-1... 44 1.6 1
(AM634488) Entamoeba dispar GSS, clone dispar124f07.q1k. 44 1.6 1
(AM628190) Entamoeba dispar GSS, clone dispar27e04.p1k. 44 1.6 1
(EJ383639) 1092963781512 Global-Ocean-Sampling_GS-28-01-01-1... 44 1.6 1
(EJ189900) 1092344182070 Global-Ocean-Sampling_GS-27-01-01-1... 44 1.6 1
(EJ097839) 1095462277354 Global-Ocean-Sampling_GS-26-01-01-1... 44 1.6 1
(EJ063274) 1095458012859 Global-Ocean-Sampling_GS-26-01-01-1... 44 1.6 1
(EJ053759) 1095456014961 Global-Ocean-Sampling_GS-26-01-01-1... 44 1.6 1
(EJ032846) 1095454054176 Global-Ocean-Sampling_GS-26-01-01-1... 44 1.6 1
(EI301116) GM_WBc0027G05.f GM_WBc Glycine max genomic clone ... 44 1.6 1
(ED770533) GM_WBb0145E14.f GM_WBb Glycine max genomic clone ... 44 1.6 1
(ED686396) GM_WBb0021J05.f GM_WBb Glycine max genomic clone ... 44 1.6 1
(CZ526806) GMW2-145E14a.b1 GMW2 Glycine max genomic, genomic... 44 1.6 1
(CR096504) Reverse strand read from insert in 5'HPRT inserti... 44 1.6 1
(CR043354) Reverse strand read from insert in 5'HPRT inserti... 44 1.6 1
(BX239697) Danio rerio genomic clone DKEY-281O17, genomic su... 44 1.6 1
(DW118669) CLRY7294.b1_L24.ab1 CLR(XYZ) lettuce serriola Lac... 44 1.6 1
(DW108403) CLRX574.b3_L23.ab1 CLR(XYZ) lettuce serriola Lact... 44 1.6 1
(DW108402) CLRX574.b2_L23.ab1 CLR(XYZ) lettuce serriola Lact... 44 1.6 1
(CF980247) rg66f06.y1 Meloidogyne hapla female SL1 pGEM Melo... 44 1.6 1
(BU094026) rf49c04.y2 Meloidogyne hapla J2 pAMP1 v1 Meloidog... 44 1.6 1
(FG284560) 1108770677796 New World Screwworm Egg 9261 ESTs C... 44 1.6 1
(FG284300) 1108770663835 New World Screwworm Egg 9261 ESTs C... 44 1.6 1
(CP000123) Mycoplasma capricolum subsp. capricolum ATCC 2734... 44 1.6 1
(AC009375) Drosophila melanogaster 3L BAC RP98-44L18 (Roswel... 38 1.6 5
(AM430451) Vitis vinifera contig VV78X077357.6, whole genome... 36 1.6 3
(BV275349) S232P6133FA3.T0 Beagle Canis familiaris STS genom... 36 1.7 2
(CU633414) Pig DNA sequence *** SEQUENCING IN PROGRESS *** f... 38 1.7 4
(AC087439) Homo sapiens chromosome 8, clone GS1-251I9, compl... 38 1.9 2
(AM090240) Lutzomyia longipalpis EST clone SFM-03b11, sequen... 32 2.1 3
(AC106321) Rattus norvegicus clone CH230-22I11, WORKING DRAF... 42 2.2 4
(DB994099) Bruguiera gymnorhiza mRNA, clone: Bg04-24_D03, 5'... 30 2.4 3
(AM476117) Vitis vinifera contig VV78X028229.19, whole genom... 34 2.4 2
(EK272712) 1095462264932 Global-Ocean-Sampling_GS-31-01-01-1... 38 2.4 2
(CK136033) SD21514.3prime SD Drosophila melanogaster Schneid... 38 2.4 2
(AC080066) Homo sapiens BAC clone CTD-2321M19 from 7, comple... 30 2.5 6
(AM469951) Vitis vinifera contig VV78X132677.4, whole genome... 36 2.5 3
(CF350428) rl58f04.y1 Meloidogyne javanica J2 SMART pGEM Mel... 36 2.6 2
(CU797618) A BAC library has been constructed from PN40024 g... 38 2.6 2
(X52881) C.carpio gene for prolactin. 42 2.6 2
(BZ911678) CH240_109H4.TJ CHORI-240 Bos taurus genomic clone... 34 2.7 2
(AM451087) Vitis vinifera contig VV78X103234.4, whole genome... 36 2.9 3
(AL034557) Plasmodium falciparum MAL4P1. 34 2.9 2
(AP001692) Homo sapiens genomic DNA, chromosome 21q, section... 30 2.9 2
(AM472559) Vitis vinifera contig VV78X148653.13, whole genom... 42 2.9 2
(EJ855558) 1093017918783 Global-Ocean-Sampling_GS-30-02-01-1... 40 2.9 2
(AM603062) Entamoeba invadens IP1 GSS, clone inv021f01.p1k. 38 3.0 2
(EG616214) REPROTRACTF088214M5 POSSUM_01-POSSUM-C-REPROTRACT... 34 3.0 2
(AC160129) Mus musculus BAC clone RP23-253N17 from chromosom... 34 3.0 2
(AC103936) Mus musculus chromosome 9, clone RP24-361K14, com... 34 3.0 2
(DV322825) NABS882TF Aedes aegypti infected with Plasmodium ... 38 3.1 2
(AC185042) Bos taurus clone CH240-266G2, WORKING DRAFT SEQUE... 34 3.1 2
(AL513011) Human DNA sequence from clone RP11-284O5 on chrom... 30 3.1 2
(CU695283) Brassica rapa subsp. pekinensis clone KBrH003E03,... 40 3.1 3
(AC069586) Homo sapiens chromosome 6 clone RP11-284O5 map 6,... 30 3.1 2
(EJ966354) 1093022044936 Global-Ocean-Sampling_GS-30-02-01-1... 40 3.2 2
(AP001342) Homo sapiens genomic DNA, chromosome 21q21.1-q21.... 30 3.3 2
(DX393609) GE__Sa0097B12.b1 Gossypium exiguum WGS library Go... 36 3.3 2
(EL927277) NY4Tr1_8_A01.b1_A039 NY4 trophonts (NY4Tr1) Ichth... 38 3.4 2
(EK448634) 1095467061742 Global-Ocean-Sampling_GS-32-01-01-1... 36 3.4 2
(CP000825) Prochlorococcus marinus str. MIT 9215, complete g... 36 3.5 11
(EJ258378) 1095349024136 Global-Ocean-Sampling_GS-27-01-01-1... 32 3.5 3
(EJ094032) 1095460243341 Global-Ocean-Sampling_GS-26-01-01-1... 38 3.5 2
(AC116984) Dictyostelium discoideum chromosome 2 map 2567470... 34 3.5 8
(AM442915) Vitis vinifera, whole genome shotgun sequence, co... 42 3.6 2
(AF411933) Plasmodium falciparum strain 7G8 normocyte-bindin... 34 3.6 2
(AF411930) Plasmodium falciparum strain HB3 normocyte-bindin... 34 3.6 2
(AF533700) Plasmodium falciparum 3D7 normocyte-binding prote... 34 3.6 2
(BZ464355) BONHD63TF BO_1.6_2_KB_tot Brassica oleracea genom... 40 3.7 2
(AM468418) Vitis vinifera contig VV78X160911.5, whole genome... 38 3.8 2
(DX531251) GH_MBb0079M19f GH_MBb Gossypium hirsutum genomic ... 36 3.9 2
(BH105600) RPCI-24-245M16.TJ RPCI-24 Mus musculus genomic cl... 34 4.1 2
(CZ459949) MCF748i11TR Human MCF7 breast cancer cell line li... 30 4.1 2
(FC646940) CAXU8739.rev CAXU Lottia gigantea from female gon... 34 4.1 2
(EL500171) 014_PFLAB1-S-P2B.AB1 Blood stage Plasmodium falci... 34 4.1 2
(FC676248) CAXX11208.rev CAXX Lottia gigantea from male gona... 34 4.1 2
(FC582248) CAXP15523.rev CAXP Lottia gigantea from head, foo... 34 4.1 2
(FC647685) CAXU9222.rev CAXU Lottia gigantea from female gon... 34 4.1 2
(FC558308) CAWF1654.rev CAWF Lottia gigantea from mantle (H)... 34 4.1 2
(FC761508) CBBN12725.rev CBBN Lottia gigantea 3,4,5,6.5d Lar... 34 4.1 2
(AG019373) Homo sapiens genomic DNA, 21q region, clone: B102... 30 4.1 2
(AG019931) Homo sapiens genomic DNA, 21q region, clone: B293... 30 4.1 2
(AG020227) Homo sapiens genomic DNA, 21q region, clone: B379... 30 4.1 2
(BH104856) RPCI-24-245K15.TJ RPCI-24 Mus musculus genomic cl... 34 4.1 2
(DE344994) Bombyx mori genomic DNA, BAC clone:BET_047_K18. 32 4.2 2
(BP512347) Hydra magnipapillata cDNA, clone:hmp_06819. 34 4.5 2
(AC200267) Pongo abelii BAC clone CH276-378F1 from chromosom... 32 4.6 7
(AC024595) Homo sapiens BAC clone RP11-84N19 from 4, complet... 38 5.2 3
(CP000207) Drosophila melanogaster genomic scaffold 21100002... 38 5.2 2
(AC196960) Zea mays chromosome 4 clone ZMMBBb-298O22; ZMMBBb... 42 5.2 2
(AC208237) Populus trichocarpa clone JGIACSB13-L10, complete... 32 5.3 4
(AM475806) Vitis vinifera contig VV78X060244.2, whole genome... 42 5.3 2
(AC097519) Homo sapiens BAC clone RP11-549K7 from 4, complet... 36 5.4 5
(AC123939) Mus musculus BAC clone RP23-418I14 from 12, compl... 36 5.7 5
(AM474828) Vitis vinifera, whole genome shotgun sequence, co... 42 5.7 2
(CK721429) tad63b10.y2 Hydra EST -Kiel 1 Hydra vulgaris cDNA... 28 5.7 3
(AP003621) Oryza sativa Japonica Group genomic DNA, chromoso... 36 5.9 3
(BS000011) Pan troglodytes chromosome 22 clone:RP43-017I17, ... 36 5.9 5
(CV068324) Le_mx0_42g01_SP6 Little Skate Multiple Tissues, N... 30 6.1 3
(AC006884) Caenorhabditis elegans clone Y57E12, *** SEQUENCI... 38 6.1 5
(AL929266) Zebrafish DNA sequence from clone CH211-67E16 in ... 42 6.2 1
(AC145725) Gasterosteus aculeatus clone CH213-173B10, comple... 42 6.2 1
(BV307453) S236P6373RE6.T0 AlaskanMalamute Canis familiaris ... 42 6.2 1
(BX284634) Mouse DNA sequence from clone RP23-92B18 on chrom... 42 6.2 1
(BX000479) Mouse DNA sequence from clone RP23-139I16 on chro... 42 6.2 1
(AC184058) Pan troglodytes BAC clone CH251-65B3 from chromos... 42 6.2 1
(AP009594) Solanum lycopersicum DNA, chromosome 8, clone: C0... 42 6.2 1
(AM486094) Vitis vinifera contig VV78X218736.5, whole genome... 42 6.2 1
(AM486006) Vitis vinifera contig VV78X240946.8, whole genome... 42 6.2 1
(AM479779) Vitis vinifera contig VV78X080401.11, whole genom... 42 6.2 1
(AM477452) Vitis vinifera contig VV78X227131.5, whole genome... 42 6.2 1
(AM475307) Vitis vinifera, whole genome shotgun sequence, co... 42 6.2 1
(AM474510) Vitis vinifera contig VV78X085094.3, whole genome... 42 6.2 1
(AM473718) Vitis vinifera contig VV78X202874.6, whole genome... 42 6.2 1
(AM461728) Vitis vinifera contig VV78X122650.10, whole genom... 42 6.2 1
(AM446111) Vitis vinifera contig VV78X222483.16, whole genom... 42 6.2 1
(AM441292) Vitis vinifera, whole genome shotgun sequence, co... 42 6.2 1
(AM428177) Vitis vinifera, whole genome shotgun sequence, co... 42 6.2 1
(AM423728) Vitis vinifera contig VV78X082511.7, whole genome... 42 6.2 1
(AC212433) Solanum lycopersicum chromosome 11 clone C11HBa00... 42 6.2 1
(AC187168) Glycine max clone gmp1-12a14, complete sequence. 42 6.2 1
(FB571381) Sequence 248 from Patent EP1865317. 42 6.2 1
(FB571325) Sequence 192 from Patent EP1865317. 42 6.2 1
(CS468880) Sequence 71 from Patent EP1748080. 42 6.2 1
(CS419357) Sequence 71 from Patent WO2006094836. 42 6.2 1
(GC740021) Sequence 55266 from patent US 6812339. 42 6.2 1
(GC740020) Sequence 55265 from patent US 6812339. 42 6.2 1
(GC698108) Sequence 13353 from patent US 6812339. 42 6.2 1
(Z70210) Caenorhabditis elegans Cosmid K08H2. 42 6.2 1
(Z69885) Caenorhabditis elegans Cosmid T04C10. 42 6.2 1
(DQ181024) Taphes brevicollis voucher UPOL 000812 large subu... 42 6.2 1
(DQ180989) Taphes brevicollis voucher UPOL 000204 large subu... 42 6.2 1
(AE014134) Drosophila melanogaster chromosome 2L, complete s... 42 6.2 1
(AC171136) Helobdella robusta clone CH306-1A7, complete sequ... 42 6.2 1
(AC009910) Drosophila melanogaster, chromosome 2L, region 25... 42 6.2 1
(AL133386) Human DNA sequence from clone RP1-181C24 on chrom... 42 6.2 1
(AC027806) Homo sapiens chromosome 11, clone RP11-328C11, co... 42 6.2 1
(AC021749) Homo sapiens chromosome 11, clone RP11-810F22, co... 42 6.2 1
(AC159677) Bos taurus clone CH240-77K21, WORKING DRAFT SEQUE... 42 6.2 1
(AC156924) Bos taurus clone CH240-48N3, WORKING DRAFT SEQUEN... 42 6.2 1
(AC156221) Bos taurus clone CH240-49E20, WORKING DRAFT SEQUE... 42 6.2 1
(AC152132) Dasypus novemcinctus clone VMRC5-198J6, WORKING D... 42 6.2 1
(AC144999) Pan troglodytes clone CH251-535N14, WORKING DRAFT... 42 6.2 1
(AC126891) Rattus norvegicus clone CH230-49A17, *** SEQUENCI... 42 6.2 1
(AC123889) Rattus norvegicus clone CH230-321P9, WORKING DRAF... 42 6.2 1
(FP085414) Zebrafish DNA sequence *** SEQUENCING IN PROGRESS... 42 6.2 1
(CU929325) Zebrafish DNA sequence *** SEQUENCING IN PROGRESS... 42 6.2 1
(CU928405) Pig DNA sequence *** SEQUENCING IN PROGRESS *** f... 42 6.2 1
(CU424464) Pig DNA sequence *** SEQUENCING IN PROGRESS *** f... 42 6.2 1
(CT841524) Pig DNA sequence *** SEQUENCING IN PROGRESS *** f... 42 6.2 1
(AC233682) Medicago truncatula, pooled multiple clones, *** ... 42 6.2 1
(AC221669) Bos taurus clone CH240-389I4, WORKING DRAFT SEQUE... 42 6.2 1
(AC220799) Bos taurus clone CH240-346G8, WORKING DRAFT SEQUE... 42 6.2 1
(AC215256) Zea mays chromosome 6 clone CH201-1L8; ZMMBBc0001... 42 6.2 1
(AC208654) Zea mays chromosome 9 clone CH201-302K10; ZMMBBc0... 42 6.2 1
(AC205404) Zea mays chromosome 6 clone CH201-448L2; ZMMBBc04... 42 6.2 1
(AC194074) Zea mays chromosome 9 clone CH201-418G11; ZMMBBc0... 42 6.2 1
(AC189280) Zea mays chromosome 4 clone CH201-191I23; ZMMBBc0... 42 6.2 1
(AC186160) Zea mays chromosome 4 clone ZMMBBb-216C17; ZMMBBb... 42 6.2 1
(AC017389) Drosophila melanogaster, *** SEQUENCING IN PROGRE... 42 6.2 1
(AC016847) Homo sapiens clone RP11-6K8, WORKING DRAFT SEQUEN... 42 6.2 1
(AZ242694) RPCI-23-88G10.TJ RPCI-23 Mus musculus genomic clo... 42 6.2 1
(ER581963) 1093015845308 Global-Ocean-Sampling_GS-36-01-01-2... 42 6.2 1
(ER527010) 1093015693199 Global-Ocean-Sampling_GS-35-01-01-1... 42 6.2 1
(ER502622) 1093015408598 Global-Ocean-Sampling_GS-35-01-01-1... 42 6.2 1
(ER387189) 1094428685794 Global-Ocean-Sampling_GS-34-01-01-1... 42 6.2 1
(EK261952) 1095462180093 Global-Ocean-Sampling_GS-31-01-01-1... 42 6.2 1
(EJ907027) 1093018518833 Global-Ocean-Sampling_GS-30-02-01-1... 42 6.2 1
(EJ872342) 1093018352465 Global-Ocean-Sampling_GS-30-02-01-1... 42 6.2 1
(AM653897) Entamoeba moshkovskii FIC GSS, clone mosh006d06.p1k. 42 6.2 1
(EJ589727) 1092961042104 Global-Ocean-Sampling_GS-29-01-01-1... 42 6.2 1
(EI942539) VUH2-86N17TR VUUBBa (VUH2) Vigna unguiculata geno... 42 6.2 1
(EI469818) PV_GBa0077D05.f PV_GBa Phaseolus vulgaris genomic... 42 6.2 1
(EI327739) GM_WBc0065N04.r GM_WBc Glycine max genomic clone ... 42 6.2 1
(ED699538) GM_WBb0040H04.f GM_WBb Glycine max genomic clone ... 42 6.2 1
(ED611192) ZMMBBc0548M08.rq ZMMBB_VAL Zea mays genomic clone... 42 6.2 1
(DX820552) MUGQ_CH252P070O18Sp6_AV1169_017 CHORI-252 Vervet ... 42 6.2 1
(DX446592) BE2002_D15_F IASMA L2 HindIII BAC library Vitis v... 42 6.2 1
(AL075279) Drosophila melanogaster genome survey sequence TE... 42 6.2 1
(DU064599) 71839 Tomato HindIII BAC Library Solanum lycopers... 42 6.2 1
(DE174353) Bombyx mori genomic DNA, Fosmid clone:RO0324-K02_R. 42 6.2 1
(CZ934704) 253764 Tomato EcoRI BAC Library Solanum lycopersi... 42 6.2 1
(CZ541667) SRAA-aad39f05.g1 Strongyloides ratti whole genome... 42 6.2 1
(CZ514523) GMW2-40H4a.b1 GMW2 Glycine max genomic, genomic s... 42 6.2 1
(CU749460) A BAC library has been constructed from PN40024 g... 42 6.2 1
(CT499537) A BAC library has been constructed from cultivar ... 42 6.2 1
(CL727837) OR_BBa0058L03.f OR_BBa Oryza nivara genomic clone... 42 6.2 1
(CL700152) SP__Ba0057K01.f SP__Ba Sorghum propinquum genomic... 42 6.2 1
(CL543280) OB__Ba0069H04.f OB__Ba Oryza brachyantha genomic ... 42 6.2 1
(CL290938) ZMMBBb0635D24r ZMMBBb (HindIII) Zea mays subsp. m... 42 6.2 1
(CG772286) 1123009B09.y1 1123 - RescueMu Grid L Zea mays gen... 42 6.2 1
(CG072385) PUKBJ15TD ZM_0.6_1.0_KB Zea mays genomic clone ZM... 42 6.2 1
(CG072382) PUKBJ15TB ZM_0.6_1.0_KB Zea mays genomic clone ZM... 42 6.2 1
(CC934589) ZMMBBc0548M08r ZMMBBc Zea mays subsp. mays genomi... 42 6.2 1
(CC261976) CH261-55A4_RM1.1 CH261 Gallus gallus genomic clon... 42 6.2 1
(BZ423735) id52g02.g1 WGS-SbicolorF (DH5a methyl filtered) S... 42 6.2 1
(BZ067559) lju12a12.g1 B.oleracea002 Brassica oleracea genom... 42 6.2 1
(BX987302) Reverse strand read from insert in 3'HPRT inserti... 42 6.2 1
(EG843898) EST_ssal_eve_36802 ssaleve thyroid Salmo salar cD... 42 6.2 1
(DW108401) CLRX574.b1_L23.ab1 CLR(XYZ) lettuce serriola Lact... 42 6.2 1
(DT802633) 107627312 TL1 Tribolium castaneum cDNA clone 1E23... 42 6.2 1
(CT858958) Oryza sativa Indica Group EST sequence:CONTIG11201. 42 6.2 1
(CR572344) Xenopus tropicalis EST, clone THdA028a03 3'. 42 6.2 1
(CO096358) GR__Ea19I22.f GR__Ea Gossypium raimondii cDNA clo... 42 6.2 1
(CO077436) GR__Ea39D13.f GR__Ea Gossypium raimondii cDNA clo... 42 6.2 1
(CO077327) GR__Ea39A20.f GR__Ea Gossypium raimondii cDNA clo... 42 6.2 1
(CO077325) GR__Ea39A19.f GR__Ea Gossypium raimondii cDNA clo... 42 6.2 1
(CK970582) 4086363 BARC 9BOV Bos taurus cDNA clone 9BOV31_H0... 42 6.2 1
(CJ383080) Molgula tectiformis cDNA, gastrula/neurula clone:... 42 6.2 1
(CJ372481) Molgula tectiformis cDNA, gastrula/neurula clone:... 42 6.2 1
(AJ928811) Theileria annulata EST, clone tam020d03_q1k. 42 6.2 1
(CF669499) RTCNT1_44_C01.b1_A029 Root control Pinus taeda cD... 42 6.2 1
(AA739901) 666 PtIFG2 Pinus taeda cDNA clone 9081M 3', mRNA ... 42 6.2 1
(FD513999) C5_TOmix_A0F08_TW C5_TOmix Caenorhabditis sp. 5 A... 42 6.2 1
(EX277890) 1564534_5_E04_012 PY06 Carica papaya cDNA, mRNA s... 42 6.2 1
(AV984767) Ciona intestinalis cDNA, clone:cilv38i14, 5' end,... 42 6.2 1
(AV954562) Ciona intestinalis cDNA, clone:cicl07i13, 5' end,... 42 6.2 1
(X95275) Plasmodium falciparum complete gene map of plastid-... 28 6.2 5
(CU179638) Zebrafish DNA sequence from clone RP71-49K16 in l... 40 6.5 5
(AC217144) Solanum lycopersicum chromosome 9 clone C09SLm000... 30 6.5 6
(AM488432) Vitis vinifera contig VV78X001385.24, whole genom... 36 6.6 3
(AC208976) Zea mays chromosome 8 clone CH201-70K1; ZMMBBc007... 38 6.8 4
(BX488292) Homo sapiens mRNA; EST DKFZp686F15269_r1 (from c... 38 6.8 2
(AF067220) Caenorhabditis elegans cosmid C33E10, complete se... 32 6.9 4
(AC116305) Dictyostelium discoideum chromosome 2 map 1005175... 30 7.2 8
(AE014298) Drosophila melanogaster chromosome X, complete se... 30 7.5 2
(AP008006) Lotus japonicus genomic DNA, chromosome 3, clone:... 40 7.5 3
(AC155082) Bos taurus clone CH240-36D23, WORKING DRAFT SEQUE... 38 7.6 3
(AP010938) Solanum lycopersicum DNA, chromosome 8, clone: C0... 32 7.6 4
(DT618374) ACAH-aaa66e04.g1 Hydra_EST_UCI-10 Hydra magnipapi... 32 7.8 2
(AC212620) Solanum lycopersicum chromosome 7 clone C07HBa005... 38 7.8 3
(DQ461522) Galaxias vulgaris strain BT2 D-loop, partial sequ... 38 7.8 2
(AC189261) Brassica rapa subsp. pekinensis clone KBrB021P11,... 38 7.8 4
(AX344641) Sequence 66 from Patent WO0200927. 36 7.9 2
(AL929355) Plasmodium falciparum strain 3D7, chromosome 9; s... 38 8.1 6
(BT001900) Drosophila melanogaster SD21514 full insert cDNA. 38 8.3 2
(AC149483) Populus trichocarpa clone Pop1-69I13, complete se... 34 8.5 3
(AC216154) Equus caballus clone CH241-249J14, WORKING DRAFT ... 36 8.5 4
(FF303202) 279354610 Pea aphid whole body normalized full le... 32 8.5 2
(AK081884) Mus musculus 16 days embryo head cDNA, RIKEN full... 32 8.6 3
(BQ705854) Y1E10C01-sh1 Drosophila yakuba 0-14 h embryo libr... 34 8.6 2
(AM445172) Vitis vinifera contig VV78X138056.7, whole genome... 36 8.7 2
(CN775982) tae79h08.x1 Hydra EST Darmstadt I Hydra magnipapi... 32 8.7 2
(CP000939) Clostridium botulinum B1 str. Okra, complete genome. 32 8.8 2
(AC117081) Dictyostelium discoideum chromosome 2 map 5862124... 32 8.8 7
(CX055168) tai89g07.x2 Hydra EST UCI 5 ALP Hydra magnipapill... 32 9.0 2
(AC157490) Medicago truncatula clone mth2-123f23, complete s... 32 9.2 5
(CP000742) Methanococcus vannielii SB, complete genome. 32 9.4 2
(DH817461) Rattus norvegicus DNA, BAC clone: RNB1-419P22, 5'... 34 9.4 2
(DQ461525) Galaxias vulgaris strain BC2 D-loop, partial sequ... 38 9.6 2
(BY921899) Bombyx mori cDNA, clone:E_EL_ovS0_09F06_F_0, 5' e... 32 9.7 2
(DQ461523) Galaxias vulgaris strain BT3 D-loop, partial sequ... 38 9.8 2
(DQ461526) Galaxias vulgaris strain BC3 D-loop, partial sequ... 38 9.8 2
(BZ469283) BONNA86TF BO_1.6_2_KB_tot Brassica oleracea genom... 38 9.8 2
(DT612725) ACAG-aaa16c07.g1 Hydra_EST_UCI-9 Hydra magnipapil... 32 9.9 2

>(BJ374398) Dictyostelium discoideum cDNA clone:ddc7j18, 3' end,
single read.
Length = 172

Score = 321 bits (162), Expect = 4e-84
Identities = 171/171 (100%)
Strand = Plus / Minus


Query: 1 taatttcatataaaaggttcattgnaaaagaagttttaattaaaaatattaaatattcaa 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 172 taatttcatataaaaggttcattgnaaaagaagttttaattaaaaatattaaatattcaa 113


Query: 61 cctatgttagagataataatggaaagattgatttatcaatttcngaatagaaaattggaa 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 112 cctatgttagagataataatggaaagattgatttatcaatttcngaatagaaaattggaa 53


Query: 121 atgcnaatactggaaaattgaaacttcaattgttagtaacaaaaataataa 171
|||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 52 atgcnaatactggaaaattgaaacttcaattgttagtaacaaaaataataa 2

Lambda K H
1.37 0.711 1.31

Matrix: blastn matrix:1 -3
Number of Sequences: 102105510
Number of Hits to DB: 276,858,937
Number of extensions: 21626446
Number of successful extensions: 5926004
Number of sequences better than 10.0: 361
Length of query: 171
Length of database: 101,790,757,118
Length adjustment: 22
Effective length of query: 149
Effective length of database: 99,544,435,898
Effective search space: 14832120948802
Effective search space used: 14832120948802
X1: 11 (21.8 bits)
S2: 21 (42.1 bits)

protein update 2009. 7.22
Homology vs Protein
Query= Contig-U03161-1 (Contig-U03161-1Q) /CSM_Contig/Contig-U03161-1Q.Seq.d
(171 letters)

Database: nrp_B
3,236,559 sequences; 1,051,180,864 total letters

Searching..................................................done

Score E
Sequences producing significant alignments: (bits) Value

AC116979_21(AC116979|pid:none) Dictyostelium discoideum chromoso... 33 4.0

>AC116979_21(AC116979|pid:none) Dictyostelium discoideum chromosome
2 map 6445720-6776760 strain AX4, complete sequence.
Length = 383

Score = 32.7 bits (73), Expect = 4.0
Identities = 14/27 (51%), Positives = 20/27 (74%)
Frame = +3

Query: 18 FIXKEVLIKNIKYSTYVRDNNGKIDLS 98
F K V I++ K++ Y+RDNNGK D+S
Sbjct: 228 FNGKNVNIRSNKFNNYIRDNNGKGDMS 254

Lambda K H
0.318 0.134 0.401

Gapped
Lambda K H
0.267 0.0410 0.140

Matrix: BLOSUM62
Gap Penalties: Existence: 11, Extension: 1
Number of Sequences: 3236559
Number of Hits to DB: 198,359,118
Number of extensions: 3200160
Number of successful extensions: 4529
Number of sequences better than 10.0: 1
Number of HSP's gapped: 4528
Number of HSP's successfully gapped: 1
Length of query: 57
Length of database: 1,051,180,864
Length adjustment: 30
Effective length of query: 27
Effective length of database: 954,084,094
Effective search space: 25760270538
Effective search space used: 25760270538
Neighboring words threshold: 12
Window for multiple hits: 40
X1: 16 ( 7.3 bits)
X2: 38 (14.6 bits)
X3: 64 (24.7 bits)
S1: 41 (21.7 bits)
S2: 26 (14.6 bits)

PSORT

psg: 0.64 gvh: 0.12 alm: 0.55 top: 0.53 tms: 0.00 mit: 0.35 mip: 0.00
nuc: 0.00 erl: 0.00 erm: 0.20 pox: 0.00 px2: 0.00 vac: 0.00 rnp: 0.00
act: 0.00 caa: 0.00 yqr: 0.00 tyr: 0.00 leu: 0.00 gpi: 0.00 myr: 0.00
dna: 0.00 rib: 0.00 bac: 0.00 m1a: 0.00 m1b: 0.00 m2 : 0.00 mNt: 0.00
m3a: 0.00 m3b: 0.00 m_ : 1.00

52.0 %: nuclear
24.0 %: cytoplasmic
12.0 %: mitochondrial
8.0 %: cytoskeletal
4.0 %: extracellular, including cell wall

>> prediction for Contig-U03161-1 is nuc

VS (DIR, S) 0
VH (FL, L) 0
VF (FL, S) 0
AH (FL, L) 0
AF (FL, S) 0
SL (DIR, L) 0
SS (DIR, S) 0
SH (FL, L) 0
SF (FL, S) 0
CH (FL, L) 0
CF (FL, S) 1
FCL (DIR, L) 0
FC (DIR, S) 0
FC-IC (SUB) 0