Contig ID Contig-U16068-1
Contig update 2004. 6.11
Contig sequence
>Contig-U16068-1 (Contig-U16068-1Q) /CSM_Contig/Contig-U16068-1Q.Seq.d

Gap gap included
Contig length 1779
Chromosome number (1..6, M) 2
Chromosome length 8467578
Start point 1316046
End point 1314268
Number of clones 18
Number of EST 29
Link to clone list U16068
List of clone(s)

Translated Amino Acid sequence


Translated Amino Acid sequence (All Frames)
Frame A:


Frame B:


Frame C:


own update 2004. 6.23
Homology vs CSM-cDNA
Query= Contig-U16068-1 (Contig-U16068-1Q)
(1789 letters)

Database: CSM
8402 sequences; 8,075,542 total letters

Score E
Sequences producing significant alignments: (bits) Value

Contig-U16068-1 (Contig-U16068-1Q) /CSM_Contig/Conti... 2418 0.0
Contig-U11902-1 (Contig-U11902-1Q) /CSM_Contig/Conti... 48 5e-05
Contig-U14143-1 (Contig-U14143-1Q) /CSM_Contig/Conti... 46 2e-04
Contig-U03623-1 (Contig-U03623-1Q) /CSM_Contig/Conti... 46 2e-04
Contig-U16343-1 (Contig-U16343-1Q) /CSM_Contig/Conti... 44 7e-04
Contig-U15684-1 (Contig-U15684-1Q) /CSM_Contig/Conti... 44 7e-04
Contig-U14248-1 (Contig-U14248-1Q) /CSM_Contig/Conti... 44 7e-04
Contig-U02912-1 (Contig-U02912-1Q) /CSM_Contig/Conti... 44 7e-04
Contig-U00425-1 (Contig-U00425-1Q) /CSM_Contig/Conti... 42 0.003
Contig-U16373-1 (Contig-U16373-1Q) /CSM_Contig/Conti... 34 0.72

>Contig-U16068-1 (Contig-U16068-1Q) /CSM_Contig/Contig-U16068-1Q.Seq.d
Length = 1789

Score = 2418 bits (1220), Expect = 0.0
Identities = 1220/1220 (100%)
Strand = Plus / Plus

Query: 471 aaaccaagatcaaataaatttgataaagtaatcattaaatcaaatggagtttgttatata 530
Sbjct: 471 aaaccaagatcaaataaatttgataaagtaatcattaaatcaaatggagtttgttatata 530

Query: 531 acagagggggtaattggaaatggctcatttggtgtcgtcactcaagcaattgtggctgat 590
Sbjct: 531 acagagggggtaattggaaatggctcatttggtgtcgtcactcaagcaattgtggctgat 590

Query: 591 accaaagaggttgtagcaataaaaaaggttttacaagaccaaagatacaagaatcgagaa 650
Sbjct: 591 accaaagaggttgtagcaataaaaaaggttttacaagaccaaagatacaagaatcgagaa 650

Query: 651 ttacaaatcatgaagatgttaaatcatataaatatagtttcattaaaaaatagtttctac 710
Sbjct: 651 ttacaaatcatgaagatgttaaatcatataaatatagtttcattaaaaaatagtttctac 710

Query: 711 acatcagataatgatgaagtttatttaaatttagtattggaatatgtgccagatacagtt 770
Sbjct: 711 acatcagataatgatgaagtttatttaaatttagtattggaatatgtgccagatacagtt 770

Query: 771 tacagagtttcaagacactatagtatgtctaaacaacctgttccaaacatttttgtaaag 830
Sbjct: 771 tacagagtttcaagacactatagtatgtctaaacaacctgttccaaacatttttgtaaag 830

Query: 831 ttatatatatatcaattgtgtagatcaataaactacattcattcacttggaatttgtcat 890
Sbjct: 831 ttatatatatatcaattgtgtagatcaataaactacattcattcacttggaatttgtcat 890

Query: 891 agagatattaaacctcaaaatttattgttggatacatcaaccagtacattaaaactttgc 950
Sbjct: 891 agagatattaaacctcaaaatttattgttggatacatcaaccagtacattaaaactttgc 950

Query: 951 gattttggaagtgcaaagatattaattaaaggagaaactaatgtttcttatatttgttca 1010
Sbjct: 951 gattttggaagtgcaaagatattaattaaaggagaaactaatgtttcttatatttgttca 1010

Query: 1011 agacattatcgtgcaccagaattaatttttggatcaacaaactatactacaacttatgat 1070
Sbjct: 1011 agacattatcgtgcaccagaattaatttttggatcaacaaactatactacaacttatgat 1070

Query: 1071 gtttgggcacattaaggatgtgttttggcagaattattattgggtcaaccggttattccc 1130
Sbjct: 1071 gtttgggcacattaaggatgtgttttggcagaattattattgggtcaaccggttattccc 1130

Query: 1131 tggtgagaatggtattgaccaattggtagagattataaaggtattgggtacaccaaccaa 1190
Sbjct: 1131 tggtgagaatggtattgaccaattggtagagattataaaggtattgggtacaccaaccaa 1190

Query: 1191 agaacaaattcatgcaatgaatccatattatacctcatttaaattcccagagatcaaagc 1250
Sbjct: 1191 agaacaaattcatgcaatgaatccatattatacctcatttaaattcccagagatcaaagc 1250

Query: 1251 aaacccatggccaagagtattcaaagctaaggatgtaccggccgaatcaattgatttaat 1310
Sbjct: 1251 aaacccatggccaagagtattcaaagctaaggatgtaccggccgaatcaattgatttaat 1310

Query: 1311 ctcaaaaatcttactttatgatccatcctcaagattaaagccagttgaaatttgtgcaca 1370
Sbjct: 1311 ctcaaaaatcttactttatgatccatcctcaagattaaagccagttgaaatttgtgcaca 1370

Query: 1371 tccattctttgatgaattaagagatccaaagacatgtcttccagatggtaaacctttacc 1430
Sbjct: 1371 tccattctttgatgaattaagagatccaaagacatgtcttccagatggtaaacctttacc 1430

Query: 1431 acccctcttcaactttacaatcgcagaacaaacttcaatcggtccaaaactagccaaaac 1490
Sbjct: 1431 acccctcttcaactttacaatcgcagaacaaacttcaatcggtccaaaactagccaaaac 1490

Query: 1491 attaattccatcacatgctatgaatcaaattgaattgccatcacctttattcccaaattt 1550
Sbjct: 1491 attaattccatcacatgctatgaatcaaattgaattgccatcacctttattcccaaattt 1550

Query: 1551 ggcaatctcttcttctaatcaatcctcctcttcaaattcaaatgcaaatgtgtcatcaaa 1610
Sbjct: 1551 ggcaatctcttcttctaatcaatcctcctcttcaaattcaaatgcaaatgtgtcatcaaa 1610

Query: 1611 tttaaattctcattctgcttcaccttcaactacctcctcctcttcttctactccaaattc 1670
Sbjct: 1611 tttaaattctcattctgcttcaccttcaactacctcctcctcttcttctactccaaattc 1670

Query: 1671 aattcctgttcaatcacctt 1690
Sbjct: 1671 aattcctgttcaatcacctt 1690

Score = 180 bits (91), Expect = 5e-45
Identities = 91/91 (100%)
Strand = Plus / Plus

Query: 189 ctgttggcctactggtattattttaatataacaatcttcatgaaatttaatattaacttt 248
Sbjct: 189 ctgttggcctactggtattattttaatataacaatcttcatgaaatttaatattaacttt 248

Query: 249 aacttttacaaatagaatagataacatcacc 279
Sbjct: 249 aacttttacaaatagaatagataacatcacc 279

Score = 174 bits (88), Expect = 3e-43
Identities = 88/88 (100%)
Strand = Plus / Plus

Query: 353 ctttaaaatgagttcaaaggatcagatattggagaaagataaaaaggagacagatgataa 412
Sbjct: 353 ctttaaaatgagttcaaaggatcagatattggagaaagataaaaaggagacagatgataa 412

Query: 413 tggcaataaaaagacaacaacaacaact 440
Sbjct: 413 tggcaataaaaagacaacaacaacaact 440

Score = 75.8 bits (38), Expect = 2e-13
Identities = 38/38 (100%)
Strand = Plus / Plus

Query: 1752 tacttcaaatcattaaaactataaacctctccaataca 1789
Sbjct: 1752 tacttcaaatcattaaaactataaacctctccaataca 1789

Score = 69.9 bits (35), Expect = 1e-11
Identities = 35/35 (100%)
Strand = Plus / Plus

Query: 74 atcaatctcaaaacaatctagttcatataatatta 108
Sbjct: 74 atcaatctcaaaacaatctagttcatataatatta 108

>Contig-U11902-1 (Contig-U11902-1Q) /CSM_Contig/Contig-U11902-1Q.Seq.d
Length = 1621

Score = 48.1 bits (24), Expect = 5e-05
Identities = 24/24 (100%)
Strand = Plus / Plus

Query: 189 ctgttggcctactggtattatttt 212
Sbjct: 2 ctgttggcctactggtattatttt 25

>Contig-U14143-1 (Contig-U14143-1Q) /CSM_Contig/Contig-U14143-1Q.Seq.d
Length = 130

Score = 46.1 bits (23), Expect = 2e-04
Identities = 23/23 (100%)
Strand = Plus / Plus

Query: 189 ctgttggcctactggtattattt 211
Sbjct: 3 ctgttggcctactggtattattt 25

Database: CSM
Posted date: Jun 21, 2004 1:35 PM
Number of letters in database: 8,075,542
Number of sequences in database: 8402

Lambda K H
1.37 0.711 1.31

Lambda K H
1.37 0.711 1.31

Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 42,335
Number of Sequences: 8402
Number of extensions: 42335
Number of successful extensions: 10952
Number of sequences better than 10.0: 355
length of query: 1789
length of database: 8,075,542
effective HSP length: 17
effective length of query: 1772
effective length of database: 7,932,708
effective search space: 14056758576
effective search space used: 14056758576
T: 0
A: 40
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 16 (32.2 bits)
dna update 2009. 3.10
Homology vs DNA
Query= Contig-U16068-1 (Contig-U16068-1Q) /CSM_Contig/Contig-U16068-1Q.Seq.d
(1789 letters)

Database: ddbj_B
98,226,423 sequences; 98,766,808,389 total letters


Score E
Sequences producing significant alignments: (bits) Value N

(L34674) Dictyostelium discoideum glycogen synthase kinase 3... 1185 0.0 4
(AC116920) Dictyostelium discoideum chromosome 2 map 4415041... 1128 0.0 3
(BJ373986) Dictyostelium discoideum cDNA clone:ddc5p15, 3' e... 1128 0.0 3
(BJ373341) Dictyostelium discoideum cDNA clone:ddc2l23, 3' e... 1128 0.0 3
(BJ372806) Dictyostelium discoideum cDNA clone:ddc14a10, 3' ... 1128 0.0 3
(BJ377102) Dictyostelium discoideum cDNA clone:ddc22i16, 3' ... 1122 0.0 2
(C94498) Dictyostelium discoideum slug cDNA, clone SSL104. 1118 0.0 1
(BJ343022) Dictyostelium discoideum cDNA clone:dda15j24, 3' ... 1108 0.0 2
(BJ377541) Dictyostelium discoideum cDNA clone:ddc24a05, 3' ... 1102 0.0 1
(BJ373974) Dictyostelium discoideum cDNA clone:ddc5m16, 3' e... 1098 0.0 1
(BJ401930) Dictyostelium discoideum cDNA clone:dds19j20, 3' ... 912 0.0 2
(BJ399969) Dictyostelium discoideum cDNA clone:dds8a10, 3' e... 1043 0.0 1
(BJ342851) Dictyostelium discoideum cDNA clone:dda15k01, 3' ... 866 0.0 2
(BJ326272) Dictyostelium discoideum cDNA clone:dda15k01, 5' ... 880 0.0 1
(BJ362904) Dictyostelium discoideum cDNA clone:ddc24a05, 5' ... 745 0.0 2
(BJ387427) Dictyostelium discoideum cDNA clone:dds2c16, 5' e... 728 0.0 2
(BJ326230) Dictyostelium discoideum cDNA clone:dda15j24, 5' ... 454 0.0 3
(BJ360360) Dictyostelium discoideum cDNA clone:ddc5p15, 5' e... 434 0.0 3
(BJ433910) Dictyostelium discoideum cDNA clone:ddv23f11, 3' ... 442 e-135 2
(BJ391244) Dictyostelium discoideum cDNA clone:dds15d21, 5' ... 299 e-127 3
(BJ359763) Dictyostelium discoideum cDNA clone:ddc2l08, 5' e... 161 e-105 3
(BJ359390) Dictyostelium discoideum cDNA clone:ddc14a10, 5' ... 170 e-103 3
(BJ360348) Dictyostelium discoideum cDNA clone:ddc5m16, 5' e... 149 6e-86 3
(BJ362397) Dictyostelium discoideum cDNA clone:ddc21i15, 5' ... 149 3e-84 3
(BJ373255) Dictyostelium discoideum cDNA clone:ddc2l08, 3' e... 214 6e-51 2
(BJ415667) Dictyostelium discoideum cDNA clone:ddv23f11, 5' ... 174 7e-39 1
(BJ359843) Dictyostelium discoideum cDNA clone:ddc2l23, 5' e... 141 1e-31 2
(BJ362814) Dictyostelium discoideum cDNA clone:ddc23i16, 5' ... 149 4e-31 1
(CJ397274) Molgula tectiformis cDNA, gonad clone:mtgd030l24,... 94 2e-24 2
(AR549265) Sequence 4396 from patent US 6747137. 62 6e-23 4
(DY887668) CeleSEQ4224 Cunninghamella elegans pBluescript (E... 70 7e-23 3
(EK492032) 1095505093727 Global-Ocean-Sampling_GS-32-01-01-1... 82 3e-19 4
(AF272672) Hydra vulgaris serine/threonine kinase GSK3 mRNA,... 60 4e-18 5
(EL360865) CCEM554.b1_D19.ab1 CCE(LMS) endive Cichorium endi... 50 5e-17 6
(BJ347708) Dictyostelium discoideum cDNA clone:dda27m19, 3' ... 96 8e-16 2
(BJ330258) Dictyostelium discoideum cDNA clone:dda27m19, 5' ... 96 9e-16 2
(EL362546) CCEM7079.b1_N17.ab1 CCE(LMS) endive Cichorium end... 56 1e-15 7
(BJ389731) Dictyostelium discoideum cDNA clone:dds19j20, 5' ... 96 1e-15 2
(EH778254) CNSS17081.b1_B23.ab1 CNS(LMS) yellow starthistle ... 50 2e-15 5
(BE579951) kq34g12.y1 TBN95TM-SSR Strongyloides stercoralis ... 84 2e-15 2
(BJ390258) Dictyostelium discoideum cDNA clone:dds21b20, 5' ... 96 5e-15 1
(BQ873999) QGI4C05.yg.ab1 QG_ABCDI lettuce salinas Lactuca s... 50 6e-15 4
(FC683645) CAXX17178.fwd CAXX Lottia gigantea from male gona... 56 8e-15 5
(EL372990) CFFM10210.b1_C10.ab1 CFF(LMS) safflower Carthamus... 42 1e-14 5
(CZ281869) cp19d04.r Candida parapsilosis Random Genomic Lib... 70 2e-14 2
(CZ292223) cp80b08.r Candida parapsilosis Random Genomic Lib... 70 2e-14 2
(CV985547) tal58e06.y1 Hydra EST UCI 7 Hydra magnipapillata ... 60 2e-14 3
(BJ401006) Dictyostelium discoideum cDNA clone:dds15d21, 3' ... 92 9e-14 1
(FC762557) CBBN13365.fwd CBBN Lottia gigantea 3,4,5,6.5d Lar... 56 9e-14 4
(X53428) Rat mRNA for glycogen synthase kinase 3 beta (EC 2.... 46 1e-13 5
(DJ007841) Primary rat hepatocyte toxicity modeling. 46 1e-13 5
(EL485357) CHUM7113.b1_A04.ab1 CHU(LMS) puzzle sunflower Hel... 54 1e-13 5
(X73653) R. norvegicus mRNA for tau protein kinase I. 46 1e-13 5
(DJ007878) Primary rat hepatocyte toxicity modeling. 46 1e-13 5
(DD317242) Primary Rat Hepatocyte Toxicity Modeling. 46 1e-13 5
(DT609231) ACAG-aab05c10.g1 Hydra_EST_UCI-9 Hydra magnipapil... 58 1e-13 3
(E08007) DNA encoding tau protein kinase I. 46 3e-13 5
(BD181611) Method of the phosphorylation of tau protein. 46 3e-13 5
(AR097211) Sequence 2 from patent US 6071694. 46 3e-13 5
(AR059074) Sequence 2 from patent US 5837853. 46 3e-13 5
(EL367469) CCES3617.b1_B17.ab1 CCE(LMS) endive Cichorium end... 50 4e-13 5
(AZ540367) ENTGP77TR Entamoeba histolytica Sheared DNA Entam... 66 7e-13 3
(FC734441) CBBG8987.rev CBBG Lottia gigantea 12,15,18h embry... 56 8e-13 4
(CX084231) EHABN56TR E. histolytica Normalized cDNA library ... 66 1e-12 3
(DY969723) CLSM2855.b1_N17.ab1 CLS(LMS) lettuce sativa Lactu... 50 2e-12 4
(EL456460) CHTM9522.b1_D06.ab1 CHT(LMS) Jerusalem artichoke ... 60 2e-12 4
(BQ854728) QGB24A23.yg.ab1 QG_ABCDI lettuce salinas Lactuca ... 50 3e-12 4
(DQ406858) Schmidtea mediterranea glycogen synthase kinase 3... 46 3e-12 3
(CO998059) wmi01-9ms4-e08 Wmi01 Welwitschia mirabilis cDNA c... 52 3e-12 3
(BT008861) Arabidopsis thaliana At1g57870 mRNA, complete cds. 52 5e-12 4
(EH767895) CNSM14766.b1_L19.ab1 CNS(LMS) yellow starthistle ... 58 7e-12 3
(EL435517) CHTM10158.b1_L19.ab1 CHT(LMS) Jerusalem artichoke... 54 7e-12 5
(BP185683) Dugesia japonica cDNA, clone: 03302_HH, expressed... 54 1e-11 3
(AY392021) Spermophilus citellus glycogen synthase kinase 3 ... 44 1e-11 5
(BT002018) Arabidopsis thaliana Unknown protein (At1g57870) ... 52 2e-11 4
(EB450639) KT7C.108E19F.051219T7 KT7 Nicotiana tabacum cDNA ... 56 2e-11 4
(CK068322) 66381rsicem_1469.y1 Oryza sativa cv. PA64s panicl... 42 4e-11 4
(EH423717) OL6151F Brassica oleracea var. alboglabra leaf cD... 50 4e-11 4
(BI863006) rm15c09.y1 Meloidogyne arenaria egg pAMP1 v1 Chia... 50 5e-11 3
(CS437351) Sequence 6 from Patent WO2006063302. 40 5e-11 4
(CS437349) Sequence 4 from Patent WO2006063302. 40 5e-11 4
(AX821914) Sequence 42 from Patent WO03068961. 40 6e-11 4
(DD058213) Nerve regeneration drug. 40 7e-11 4
(DJ084509) A method of preparation a biotinylation protein a... 40 7e-11 4
(CS437354) Sequence 9 from Patent WO2006063302. 40 7e-11 4
(AX701656) Sequence 6 from Patent WO03000882. 40 7e-11 4
(EU302497) Homo sapiens GSK3beta isoform (GSK3B) mRNA, compl... 40 7e-11 4
(CR536510) Homo sapiens full open reading frame cDNA clone R... 40 7e-11 4
(AB385047) Synthetic construct DNA, clone: pF1KB5120, Homo s... 40 7e-11 4
(AY335634) Synthetic construct Homo sapiens glycogen synthas... 40 7e-11 4
(CS437348) Sequence 3 from Patent WO2006063302. 40 7e-11 4
(CS437347) Sequence 2 from Patent WO2006063302. 40 7e-11 4
(AB181914) Dugesia japonica Dj0167HH mRNA for glycogen synth... 54 8e-11 3
(DQ895714) Synthetic construct Homo sapiens clone IMAGE:1000... 40 8e-11 4
(DQ892501) Synthetic construct clone IMAGE:100005131; FLH186... 40 8e-11 4
(EY093125) CAZI21066.fwd CAZI Artemisia annua normalized lea... 50 8e-11 4
(CS437346) Sequence 1 from Patent WO2006063302. 40 9e-11 4
(CS382311) Sequence 256 from Patent EP1690548. 40 9e-11 4
(BD357620) Antisense modulation of glycogen synthase kinase ... 40 9e-11 4
(BD301157) Glycogen Synthase Kinase Function in Endothelial ... 40 9e-11 4
(AX777402) Sequence 256 from Patent WO03040301. 40 9e-11 4
(AX701653) Sequence 3 from Patent WO03000882. 40 9e-11 4
(AR270851) Sequence 1414 from patent US 6500938. 40 9e-11 4
(AR262205) Sequence 3 from patent US 6323029. 40 9e-11 4
(L33801) Human protein kinase mRNA, complete cds. 40 9e-11 4
(CS482947) Sequence 182 from Patent WO2006020269. 40 1e-10 4
(DY963747) CLSM13988.b1_H17.ab1 CLS(LMS) lettuce sativa Lact... 50 1e-10 3
(DW117277) CLRY6009.b1_A16.ab1 CLR(XYZ) lettuce serriola Lac... 50 1e-10 3
(CS618295) Sequence 215 from Patent WO2006055786. 40 1e-10 4
(CS160757) Sequence 1 from Patent WO2005083105. 40 1e-10 4
(CQ981289) Sequence 144 from Patent EP1498424. 40 1e-10 4
(CQ896514) Sequence 338 from Patent WO2004076614. 40 1e-10 4
(BC000251) Homo sapiens glycogen synthase kinase 3 beta, mRN... 40 1e-10 4
(AK290897) Homo sapiens cDNA FLJ75266 complete cds, highly s... 40 2e-10 4
(CR617019) full-length cDNA clone CS0DB003YJ02 of Neuroblast... 40 2e-10 4
(EE621381) CHWM8498.b1_C13.ab1 CHW(LMS) silverleaf sunflower... 46 2e-10 4
(CQ498418) Sequence 30285 from Patent WO0160860. 40 2e-10 4
(DV688796) CGN-31615 Leaf Coffea canephora cDNA clone cccl10... 40 2e-10 4
(EE615346) CHWM2794.b1_D03.ab1 CHW(LMS) silverleaf sunflower... 46 2e-10 4
(EF637040) Oryza sativa (japonica cultivar-group) RIM11-like... 42 2e-10 4
(E08052) cDNA encoding human tauproteinkinase-1. 40 3e-10 4
(BD301154) Glycogen Synthase Kinase Function in Endothelial ... 40 3e-10 4
(AR097210) Sequence 1 from patent US 6071694. 40 3e-10 4
(AR059073) Sequence 1 from patent US 5837853. 40 3e-10 4
(GE512815) CCFT8659.b1_E06.ab1 CCF(STU) sunflower Helianthus... 56 3e-10 3
(EL421918) CHCM1476.b1_H10.ab1 CHC(LMS) Texas blueweed Helia... 44 3e-10 5
(BC012760) Homo sapiens glycogen synthase kinase 3 beta, mRN... 40 4e-10 4
(DN941395) 56059.2 After-Cooking Darkening C Solanum tuberos... 48 4e-10 3
(CV431634) 56059.1 After-Cooking Darkening C Solanum tuberos... 48 4e-10 3
(AW919724) EST351028 Rat gene index, normalized rat, norvegi... 46 6e-10 4
(ES563304) TPAF-aab91h10.g1 T.spiralis_EST Trichinella spira... 50 7e-10 5
(CN462602) 5448.1 After-Cooking Darkening A Solanum tuberosu... 48 8e-10 3
(EF147565) Populus trichocarpa clone WS0123_H20 unknown mRNA. 46 8e-10 4
(AK286913) Glycine max cDNA, clone: GMFL01-40-B22. 56 9e-10 3
(AK072390) Oryza sativa Japonica Group cDNA clone:J023081B07... 42 1e-09 4
(EV191536) 0089017 Brassica napus Cold acclimation - dark Br... 50 1e-09 3
(GE499687) CCFT1858.b1_D10.ab1 CCF(STU) sunflower Helianthus... 54 1e-09 3
(EL455329) CHTM7972.b1_H02.ab1 CHT(LMS) Jerusalem artichoke ... 44 1e-09 4
(EH771048) CNSM3671.b1_M06.ab1 CNS(LMS) yellow starthistle C... 58 2e-09 2
(EH775118) CNSM7419.b1_F07.ab1 CNS(LMS) yellow starthistle C... 58 2e-09 2
(CS632394) Sequence 160 from Patent WO2007051866. 52 3e-09 4
(AX507663) Sequence 2358 from Patent WO0216655. 52 3e-09 4
(EL350886) CCEL7516.b1_G08.ab1 CCE(LMS) endive Cichorium end... 42 4e-09 4
(DY916116) CHAY12010.b1_D03.ab1 CHA(XYZ) common wild sunflow... 48 4e-09 4
(AY093347) Arabidopsis thaliana shaggy related protein kinas... 52 4e-09 4
(EX834053) CBNB4335.fwd CBNB Phycomyces blakesleeanus NRRL15... 42 5e-09 3
(DR916194) EST1107733 Aquilegia cDNA library Aquilegia formo... 58 5e-09 3
(EX851563) CBNC9089.fwd CBNC Phycomyces blakesleeanus NRRL15... 42 5e-09 3
(EY093124) CAZI21066.rev CAZI Artemisia annua normalized lea... 50 5e-09 3
(BX823861) Arabidopsis thaliana Full-length cDNA Complete se... 52 6e-09 4
(AY062713) Arabidopsis thaliana shaggy related protein kinas... 52 6e-09 4
(X75431) A.thaliana ASK-gamma mRNA. 52 7e-09 4
(Y11527) Oryza sativa mRNA for serine/threonine protein kina... 40 7e-09 4
(CS632388) Sequence 154 from Patent WO2007051866. 52 7e-09 4
(BT013526) Lycopersicon esculentum clone 132244R, mRNA seque... 46 7e-09 3
(AY085752) Arabidopsis thaliana clone 17739 mRNA, complete s... 52 8e-09 4
(AK227034) Arabidopsis thaliana mRNA for shaggy related prot... 52 8e-09 4
(AB451356) Homo sapiens GSK3B mRNA for glycogen synthase kin... 40 1e-08 4
(EL389535) CFFM26754.b1_C18.ab1 CFF(LMS) safflower Carthamus... 40 1e-08 4
(EH773305) CNSM5754.b1_D24.ab1 CNS(LMS) yellow starthistle C... 44 1e-08 3
(BQ414633) GA__Ed0089B03r Gossypium arboreum 7-10 dpa fiber ... 50 1e-08 3
(EL448185) CHTM26890.b1_C03.ab1 CHT(LMS) Jerusalem artichoke... 68 1e-08 2
(DW084626) CLPX7652.b1_H18.ab1 CLP(XYZ) lettuce perennis Lac... 68 1e-08 2
(DW081440) CLPX4320.b1_O23.ab1 CLP(XYZ) lettuce perennis Lac... 68 1e-08 2
(DW120739) CLRY9378.b1_D17.ab1 CLR(XYZ) lettuce serriola Lac... 74 1e-08 2
(DW084595) CLPX7622.b1_L10.ab1 CLP(XYZ) lettuce perennis Lac... 68 2e-08 2
(DW167563) CLVY5970.b1_C06.ab1 CLV(XYZ) lettuce virosa Lactu... 68 2e-08 2
(DW092590) CLPY389.b1_I01.ab1 CLP(XYZ) lettuce perennis Lact... 68 2e-08 2
(FE681427) Pv023D_M13F_E03.ab1 Phaseolus vulgaris cv Early g... 40 2e-08 5
(DT580011) wmi03-9ms2-f11 Wmi03 Welwitschia mirabilis cDNA c... 52 2e-08 3
(BU048663) PP_LEa0036J22f Peach developing fruit mesocarp Pr... 74 2e-08 1
(EH775998) CNSM8287.b1_M08.ab1 CNS(LMS) yellow starthistle C... 44 2e-08 3
(EV529886) RR1A774JQ RR1(CS) Raphanus raphanistrum subsp. ma... 46 2e-08 3
(EL440534) CHTM17011.b1_F05.ab1 CHT(LMS) Jerusalem artichoke... 56 2e-08 3
(AM652267) Entamoeba moshkovskii FIC GSS, clone mosh113c04.q1k. 58 3e-08 2
(DQ402057) Schmidtea mediterranea glycogen synthase kinase 3... 40 3e-08 5
(DY747762) 186828 Pigtailed macaque testis library Macaca ne... 38 3e-08 4
(EE617540) CHWM4921.b1_B08.ab1 CHW(LMS) silverleaf sunflower... 40 3e-08 3
(GE883581) 1112934290890 BABEVCEREB-C-01-1-7KB Papio anubis ... 40 4e-08 4
(EU239382) Ovis aries glycogen synthase kinase-3 beta mRNA, ... 40 4e-08 4
(EY940841) RS2EB54TF RS2(RS) Raphanus sativus cDNA 5', mRNA ... 50 5e-08 3
(CA781840) 052B02AF Infected Arabidopsis Leaf Arabidopsis th... 52 5e-08 3
(EU586114) Sus scrofa glycogen synthase kinase 3 beta (GSK3-... 38 5e-08 4
(EX295663) 1609316_5_G02_009 PY06 Carica papaya cDNA, mRNA s... 52 5e-08 3
(DY918532) CHAY1874.b1_D14.ab1 CHA(XYZ) common wild sunflowe... 50 6e-08 2
(DC858137) Macaca fascicularis mRNA, clone: QspA-27242, 5' e... 38 6e-08 4
(FD551290) RR3FI89TF RR3(NY) Raphanus raphanistrum subsp. ra... 50 7e-08 3
(FD547187) RR3FI89JQ RR3(NY) Raphanus raphanistrum subsp. ra... 50 7e-08 3
(EB440054) KN6B.105D10F.060104T7 KN6B Nicotiana tabacum cDNA... 56 7e-08 3
(DY945255) CHPY13577.b1_B11.ab1 CHP(XYZ) plains sunflower He... 54 7e-08 3
(EL440409) CHTM1688.b1_P13.ab1 CHT(LMS) Jerusalem artichoke ... 54 8e-08 3
(EL484942) CHUM6734.b1_K04.ab1 CHU(LMS) puzzle sunflower Hel... 54 8e-08 3
(EB428120) KF8B.200D20F.060120T7 KF8 Nicotiana tabacum cDNA ... 56 9e-08 3
(BQ966031) QHB23M07.yg.ab1 QH_ABCDI sunflower RHA801 Heliant... 44 9e-08 4
(DY944187) CHPY12091.b1_F23.ab1 CHP(XYZ) plains sunflower He... 54 9e-08 3
(DY801854) MTUNUL1.P68.B05 NUL Populus fremontii x Populus a... 42 9e-08 3
(DY910223) CHAX5188.b1_G02.ab1 CHA(XYZ) common wild sunflowe... 54 9e-08 3
(FG164560) AGN_RNC012xg05f1.ab1 AGN_RNC Nicotiana tabacum cD... 56 1e-07 3
(DW113507) CLRY1602.b1_C17.ab1 CLR(XYZ) lettuce serriola Lac... 50 1e-07 2
(EX295835) 1609749_5_I03_008 PY06 Carica papaya cDNA, mRNA s... 52 1e-07 2
(DW065463) CLLY5046.b1_K13.ab1 CLL(XYZ) lettuce saligna Lact... 50 1e-07 2
(EX227891) PY01007X1F09.f1 PY01 Carica papaya cDNA, mRNA seq... 52 1e-07 2
(EX231681) PY01077X1E11.f1 PY01 Carica papaya cDNA, mRNA seq... 52 1e-07 2
(EX231067) PY01048X1A06.f1 PY01 Carica papaya cDNA, mRNA seq... 52 1e-07 2
(EX231739) PY01069X1F07.f1 PY01 Carica papaya cDNA, mRNA seq... 52 1e-07 2
(EE621263) CHWM8389.b1_J10.ab1 CHW(LMS) silverleaf sunflower... 44 1e-07 4
(EE621691) CHWM8784.b1_P12.ab1 CHW(LMS) silverleaf sunflower... 44 1e-07 4
(EE620594) CHWM7764.b1_G21.ab1 CHW(LMS) silverleaf sunflower... 44 1e-07 4
(EL456862) CHTM9933.b1_J12.ab1 CHT(LMS) Jerusalem artichoke ... 44 1e-07 3
(BQ972051) QHB9J17.yg.ab1 QH_ABCDI sunflower RHA801 Helianth... 44 1e-07 4
(BE039085) AB09D10 AB Arabidopsis thaliana cDNA 5' similar t... 52 2e-07 3
(EX075607) BR060251 root cDNA library KBRT Brassica rapa sub... 42 2e-07 3
(EY510150) EST_lsal_pm_800610 lsalpm whole Lepeophtheirus sa... 42 2e-07 4
(EL451371) CHTM4256.b1_O07.ab1 CHT(LMS) Jerusalem artichoke ... 68 2e-07 2
(BU635308) 018H11 Infected Arabidopsis Leaf Arabidopsis thal... 42 3e-07 3
(EY043074) CAIY654.fwd CAIY Artemisia annua leaf Artemisia a... 50 3e-07 3
(BX823376) Arabidopsis thaliana Full-length cDNA Complete se... 52 3e-07 3
(AK285317) Glycine max cDNA, clone: GMFL01-07-G02. 52 3e-07 3
(GE568280) CCHT2951.b1_M18.ab1 CCHT Niger Seed Guizotia abys... 42 3e-07 4
(EX122502) BR106332 mature green leaf cDNA library KHLM Bras... 42 3e-07 3
(FG115719) PRAG-aac61b08.g1 Sand_fly_EST_Normalized Phleboto... 42 3e-07 4
(GE505022) CCFT4588.b1_H20.ab1 CCF(STU) sunflower Helianthus... 54 3e-07 3
(DY947197) CHPY2540.b1_G12.ab1 CHP(XYZ) plains sunflower Hel... 48 3e-07 3
(DY821577) CTOY13421.b1_J20.ab1 CTO(XYZ) dandelion Taraxacum... 60 3e-07 3
(FF561056) MUSR615TF MUSR Musa acuminata cDNA 5', mRNA seque... 44 3e-07 4
(EL513970) CHUY742.b1_L18.ab1 CHU(XYZ) puzzle sunflower Heli... 48 4e-07 3
(AZ693147) ENTKV69TF Entamoeba histolytica Sheared DNA Entam... 54 4e-07 2
(EX230931) PY01054X1B06.f1 PY01 Carica papaya cDNA, mRNA seq... 50 4e-07 2
(EE516120) 36RDBRG_UP_001_A10_09JUN2004_080 Brassica rapa 36... 42 4e-07 4
(BC146176) Bos taurus hypothetical protein LOC790875, mRNA (... 44 4e-07 4
(DY944329) CHPY12236.b1_H12.ab1 CHP(XYZ) plains sunflower He... 42 5e-07 3
(AC079991) Arabidopsis thaliana chromosome 1 BAC F13D13 geno... 52 5e-07 4
(EX099848) BR086138 root cDNA library KFRT Brassica rapa sub... 42 6e-07 4
(EX071339) BR055984 seedling cDNA library KBPS Brassica rapa... 42 6e-07 4
(AY142595) Arabidopsis thaliana putative shaggy kinase alpha... 42 6e-07 3
(AJ758518) Gerbera hybrid cv. 'Terra Regina' EST, clone G000... 46 7e-07 3
(AL008970) Plasmodium falciparum MAL3P4. 54 7e-07 9
(FL657355) Embrapa_Musa_ABB_NonStressed_Cachaco_N154TFB Embr... 50 7e-07 4
(CX186290) C12_45-86_06.ab1 leaf inoculated with Marssonia p... 48 7e-07 2
(DR696847) Lr_CHECF_83D07_M13R Earthworm Head Enriched libra... 56 7e-07 2
(DV700374) CGN-46366 Seed of Late Development Stage Coffea c... 46 8e-07 3
(DR075986) Lr_CHECF_52E09_M13R Earthworm Head Enriched libra... 56 8e-07 2
(CK266410) EST712488 potato abiotic stress cDNA library Sola... 40 8e-07 4
(AI730097) BNLGHi6146 Six-day Cotton fiber Gossypium hirsutu... 52 8e-07 3
(AF428327) Arabidopsis thaliana AT5g26750/F2P16_10 mRNA, com... 42 1e-06 3
(CS632386) Sequence 152 from Patent WO2007051866. 42 1e-06 3
(AY046024) Arabidopsis thaliana putative shaggy kinase alpha... 42 1e-06 3
(EH747417) CNMS6830.b1_L04.ab1 CNM(LMS) spotted knapweed Cen... 68 1e-06 1
(DY970893) CLSM4384.b1_P15.ab1 CLS(LMS) lettuce sativa Lactu... 68 1e-06 1
(DY965921) CLSM17128.b1_O10.ab1 CLS(LMS) lettuce sativa Lact... 68 1e-06 1
(DW139976) CLSY7628.b1_H12.ab1 CLS(XYZ) lettuce sativa Lactu... 68 1e-06 1
(DW137661) CLSY5119.b1_N07.ab1 CLS(XYZ) lettuce sativa Lactu... 68 1e-06 1
(DW133227) CLSX9911.b1_N06.ab1 CLS(XYZ) lettuce sativa Lactu... 68 1e-06 1
(DW130234) CLSX6934.b1_K05.ab1 CLS(XYZ) lettuce sativa Lactu... 68 1e-06 1
(BQ997395) QGG16F11.yg.ab1 QG_EFGHJ lettuce serriola Lactuca... 68 1e-06 1
(BQ866296) QGC7J08.yg.ab1 QG_ABCDI lettuce salinas Lactuca s... 68 1e-06 1
(BQ862280) QGC20K18.yg.ab1 QG_ABCDI lettuce salinas Lactuca ... 68 1e-06 1
(DT754894) EST1188743 Aquilegia cDNA library Aquilegia formo... 58 1e-06 3
(AL521664) human full-length cDNA 3-PRIME end of clone CS0DB... 40 1e-06 3
(AZ679062) ENTLZ22TF Entamoeba histolytica Sheared DNA Entam... 50 1e-06 2
(BH139839) ENTNL79TR Entamoeba histolytica Sheared DNA Entam... 50 1e-06 2
(BH146823) ENTQG45TF Entamoeba histolytica Sheared DNA Entam... 50 1e-06 2
(CX095197) EHAGA19TR E. histolytica Normalized cDNA library ... 50 1e-06 2
(AJ758862) Gerbera hybrid cv. 'Terra Regina' EST, clone G000... 46 1e-06 4
(BP962083) Euphorbia tirucalli mRNA, clone: ETC002A11, 5' end. 58 1e-06 2
(EG473784) AYBBH10TF pooled cDNA populations Arabidopsis tha... 52 2e-06 2
(CQ719548) Sequence 5482 from Patent WO02068579. 40 2e-06 3
(EL354129) CCEM10792.b1_O09.ab1 CCE(LMS) endive Cichorium en... 32 2e-06 5
(EH731654) CNMM4617.b1_A03.ab1 CNM(LMS) spotted knapweed Cen... 38 2e-06 3
(AI965724) sc77g05.y1 Gm-c1018 Glycine max cDNA clone GENOME... 58 2e-06 2
(EV057834) BNSCS3CT_UP_264_D05_18MAY2007_041 Brassica napus ... 50 2e-06 2
(CX175916) E02_69-2_10.ab1 leaf inoculated with Marssonia pa... 46 2e-06 2
(EG663465) RCLE046TP Castor bean cDNA library from leaves, 1... 38 2e-06 4
(BJ552082) Hordeum vulgare subsp. spontaneum strain H602 cDN... 44 2e-06 3
(BJ552583) Hordeum vulgare subsp. spontaneum strain H602 cDN... 44 2e-06 3
(BQ917029) QHB20A22.yg.ab1 QH_ABCDI sunflower RHA801 Heliant... 46 2e-06 3
(BD365141) Newly found single nucleotide polymorphisms (SNPs... 44 2e-06 3
(AV927751) Hordeum vulgare subsp. vulgare cv.Haruna Nijo cDN... 44 2e-06 3
(BD365143) Newly found single nucleotide polymorphisms (SNPs... 44 3e-06 3
(BD365137) Newly found single nucleotide polymorphisms (SNPs... 44 3e-06 3
(EY910403) RR3DH30JQ RR3(NY) Raphanus raphanistrum subsp. ra... 50 3e-06 2
(CX170504) G11_69-43_13.ab1 leaf inoculated with Marssonia p... 46 3e-06 2
(DV466516) MTUNUL1.P6.F11 NUL Populus fremontii x Populus an... 46 3e-06 2
(EW735268) RS3B758TF RS3(RT) Raphanus sativus cDNA 5', mRNA ... 50 3e-06 2
(EW738252) RS3B758JQ RS3(RT) Raphanus sativus cDNA 3', mRNA ... 50 3e-06 2
(EG659984) RCLF973TP Castor bean cDNA library from leaves, 1... 38 3e-06 4
(BJ552379) Hordeum vulgare subsp. spontaneum strain H602 cDN... 44 3e-06 3
(EV123645) 0128957 Brassica napus Root library Brassica napu... 60 3e-06 2
(EE606866) CHWL2209.b1_B02.ab1 CHW(LMS) silverleaf sunflower... 60 3e-06 2
(CS437352) Sequence 7 from Patent WO2006063302. 38 3e-06 3
(CS437356) Sequence 11 from Patent WO2006063302. 38 3e-06 3
(CV105575) AGENCOURT_31527437 NIH_MGC_238 Rattus norvegicus ... 46 3e-06 3
(EE607516) CHWL2891.b1_E04.ab1 CHW(LMS) silverleaf sunflower... 54 3e-06 3
(DT507911) WS02419.BR_I20 PTxD-ICC-N-A-14 Populus trichocarp... 46 3e-06 2
(CV107309) AGENCOURT_31527821 NIH_MGC_238 Rattus norvegicus ... 46 3e-06 3
(DY910632) CHAX5588.b1_G06.ab1 CHA(XYZ) common wild sunflowe... 60 3e-06 2
(EX075298) BR059942 root cDNA library KBRT Brassica rapa sub... 42 3e-06 3
(EX257024) 1436992_5_F22_091 PY06 Carica papaya cDNA, mRNA s... 40 4e-06 4
(CS437358) Sequence 13 from Patent WO2006063302. 38 4e-06 3
(DY909625) CHAX4591.b1_N20.ab1 CHA(XYZ) common wild sunflowe... 54 4e-06 3
(DV703161) CGN-49670 Seed of Late Development Stage Coffea c... 40 4e-06 3
(CS437350) Sequence 5 from Patent WO2006063302. 38 4e-06 3
(CT764694) Paramecium tetraurelia 5-PRIME EST from clone LK0... 66 5e-06 1
(EL448758) CHTM2742.b1_K13.ab1 CHT(LMS) Jerusalem artichoke ... 54 5e-06 2
(EL453998) CHTM6705.b1_B21.ab1 CHT(LMS) Jerusalem artichoke ... 54 5e-06 2
(DY910762) CHAX5715.b1_F14.ab1 CHA(XYZ) common wild sunflowe... 54 5e-06 2
(DY941114) CHPX8935.b1_N01.ab1 CHP(XYZ) plains sunflower Hel... 54 5e-06 2
(DY910548) CHAX5505.b1_B09.ab1 CHA(XYZ) common wild sunflowe... 54 5e-06 2
(DY910791) CHAX5743.b1_N20.ab1 CHA(XYZ) common wild sunflowe... 54 5e-06 2
(EL435559) CHTM10200.b1_O06.ab1 CHT(LMS) Jerusalem artichoke... 54 5e-06 2
(DY906483) CHAX13596.b2_H15.ab1 CHA(XYZ) common wild sunflow... 54 5e-06 2
(DY904257) CHAX10567.b2_M02.ab1 CHA(XYZ) common wild sunflow... 54 5e-06 2
(EE610889) CHWL680.b1_P02.ab1 CHW(LMS) silverleaf sunflower ... 54 5e-06 2
(EL435357) CHTL995.b1_E10.ab1 CHT(LMS) Jerusalem artichoke H... 54 5e-06 2
(DY939585) CHPX6531.b1_E01.ab1 CHP(XYZ) plains sunflower Hel... 54 5e-06 2
(DY913480) CHAX8856.b1_O05.ab1 CHA(XYZ) common wild sunflowe... 54 5e-06 2
(DY911501) CHAX6802.b1_C22.ab1 CHA(XYZ) common wild sunflowe... 54 5e-06 2
(EL455406) CHTM8050.b1_D22.ab1 CHT(LMS) Jerusalem artichoke ... 54 5e-06 2
(EL444928) CHTM2176.b1_O16.ab1 CHT(LMS) Jerusalem artichoke ... 54 5e-06 2
(DY923278) CHAY6467.b1_F10.ab1 CHA(XYZ) common wild sunflowe... 54 5e-06 2
(DY910392) CHAX535.b1_N13.ab1 CHA(XYZ) common wild sunflower... 54 5e-06 2
(DY904095) CHAX10390.b2_K05.ab1 CHA(XYZ) common wild sunflow... 54 5e-06 2
(EL513757) CHUY525.b1_J11.ab1 CHU(XYZ) puzzle sunflower Heli... 54 5e-06 2
(DY934089) CHPX12483.b1_E02.ab1 CHP(XYZ) plains sunflower He... 54 5e-06 2
(DY925540) CHAY9049.b1_A08.ab1 CHA(XYZ) common wild sunflowe... 54 5e-06 2
(EL476432) CHUL4354.b1_D09.ab1 CHU(LMS) puzzle sunflower Hel... 54 5e-06 2
(DY948557) CHPY4280.b1_O13.ab1 CHP(XYZ) plains sunflower Hel... 54 5e-06 2
(DY925776) CHAY9290.b1_C19.ab1 CHA(XYZ) common wild sunflowe... 54 5e-06 2
(CD854469) DH0AMM30ZB05ZZM1 HaDevR6 Helianthus annuus cDNA c... 54 5e-06 2
(DY944132) CHPY12035.b1_F09.ab1 CHP(XYZ) plains sunflower He... 54 5e-06 2
(DY940035) CHPX779.b1_E03.ab1 CHP(XYZ) plains sunflower Heli... 54 5e-06 2
(DY906515) CHAX13629.b2_J23.ab1 CHA(XYZ) common wild sunflow... 54 5e-06 2
(GE495302) CCFS6946.b1_C09.ab1 CCF(STU) sunflower Helianthus... 54 5e-06 2
(DY913593) CHAX8986.b1_D15.ab1 CHA(XYZ) common wild sunflowe... 54 5e-06 2
(DY939380) CHPX6312.b1_P17.ab1 CHP(XYZ) plains sunflower Hel... 54 5e-06 2
(DY936191) CHPX2260.b1_H14.ab1 CHP(XYZ) plains sunflower Hel... 54 5e-06 2
(EE610292) CHWL5901.b1_J11.ab1 CHW(LMS) silverleaf sunflower... 54 5e-06 2
(DY906983) CHAX1683.b1_F13.ab1 CHA(XYZ) common wild sunflowe... 54 5e-06 2
(EL438878) CHTM14078.b1_K16.ab1 CHT(LMS) Jerusalem artichoke... 54 5e-06 2
(DY913841) CHAX9267.b1_E13.ab1 CHA(XYZ) common wild sunflowe... 54 5e-06 2
(EL441251) CHTM1776.b1_O12.ab1 CHT(LMS) Jerusalem artichoke ... 54 5e-06 2
(EL446191) CHTM25028.b1_G17.ab1 CHT(LMS) Jerusalem artichoke... 54 5e-06 2
(EE607448) CHWL2823.b1_N09.ab1 CHW(LMS) silverleaf sunflower... 54 5e-06 2
(DY925452) CHAY8959.b1_N07.ab1 CHA(XYZ) common wild sunflowe... 54 5e-06 2
(DY934709) CHPX13600.b1_P15.ab1 CHP(XYZ) plains sunflower He... 54 5e-06 2
(EL437265) CHTM12242.b1_D14.ab1 CHT(LMS) Jerusalem artichoke... 54 5e-06 2
(EL420762) CHCL902.b1_L09.ab1 CHC(LMS) Texas blueweed Helian... 54 5e-06 2
(DY940170) CHPX792.b1_O05.ab1 CHP(XYZ) plains sunflower Heli... 54 5e-06 2
(EL436973) CHTM11974.b1_K17.ab1 CHT(LMS) Jerusalem artichoke... 54 5e-06 2
(EE607041) CHWL2392.b1_O21.ab1 CHW(LMS) silverleaf sunflower... 54 5e-06 2
(EE606014) CHWL10293.b1_J06.ab1 CHW(LMS) silverleaf sunflowe... 54 5e-06 2
(EL420978) CHCL922.b1_D15.ab1 CHC(LMS) Texas blueweed Helian... 54 5e-06 2
(EE608901) CHWL4261.b1_I09.ab1 CHW(LMS) silverleaf sunflower... 54 5e-06 2
(EL437301) CHTM12275.b1_F22.ab1 CHT(LMS) Jerusalem artichoke... 54 5e-06 2
(EE635537) CHEL6301.b1_J15.ab1 CHE(LMS) serpentine sunflower... 54 5e-06 2
(GE489595) CCFS4211.b1_F22.ab1 CCF(STU) sunflower Helianthus... 54 5e-06 2
(EE638279) CHEL9662.b1_K15.ab1 CHE(LMS) serpentine sunflower... 54 5e-06 2
(EE611562) CHWL868.b1_H01.ab1 CHW(LMS) silverleaf sunflower ... 54 5e-06 2
(EL447867) CHTM26592.b1_O23.ab1 CHT(LMS) Jerusalem artichoke... 54 5e-06 2
(EE636654) CHEL7260.b1_H16.ab1 CHE(LMS) serpentine sunflower... 54 5e-06 2
(EE642136) CHEL7931.b1_E16.ab1 CHE(LMS) serpentine sunflower... 54 5e-06 2
(EE621460) CHWM8570.b1_D07.ab1 CHW(LMS) silverleaf sunflower... 54 5e-06 2
(EE633663) CHEL10593.b1_A10.ab1 CHE(LMS) serpentine sunflowe... 54 5e-06 2
(DY935057) CHPX14015.b1_N23.ab1 CHP(XYZ) plains sunflower He... 54 5e-06 2
(EE608954) CHWL4310.b1_K21.ab1 CHW(LMS) silverleaf sunflower... 54 5e-06 2
(EL476811) CHUL5055.b1_M15.ab1 CHU(LMS) puzzle sunflower Hel... 54 5e-06 2
(EE634979) CHEL5823.b1_M15.ab1 CHE(LMS) serpentine sunflower... 54 5e-06 2
(EL448999) CHTM27642.b1_D24.ab1 CHT(LMS) Jerusalem artichoke... 54 5e-06 2
(EL440902) CHTM17353.b1_A19.ab1 CHT(LMS) Jerusalem artichoke... 54 5e-06 2
(EE630337) CHEL1698.b1_D17.ab1 CHE(LMS) serpentine sunflower... 54 5e-06 2
(Y11591) R.communis mRNA for shaggy-like kinase, partial. 38 6e-06 4
(ES806797) UFL_645_93 Cotton fiber 0-10 day post anthesis Go... 44 7e-06 4
(ES800626) UFL_528_14 Cotton fiber 0-10 day post anthesis Go... 44 8e-06 4
(FG183283) AGN_PNL206cf1_f6.trimmed.seq AGN_PNL Nicotiana ta... 50 9e-06 3
(DV699053) CGN-44807 Seed of Late Development Stage Coffea c... 40 9e-06 3
(DY529792) Sb059 Salicornia bigelovii Torr. cDNA library bas... 42 9e-06 4
(CF509194) USDA-FP_124000-699 Immature Ovaries from field-co... 40 9e-06 4
(EE544037) 9RDBNGA_UP_047_A04_05DEC2003_032 Brassica napus -... 48 1e-05 2
(DY812680) CTOX21433.b3_B08.ab1 CTO(XYZ) dandelion Taraxacum... 42 1e-05 4
(AM196925) Paracentrotus lividus EST, clone MPMGp1172L1240Q,... 42 1e-05 3
(EE636007) CHEL10818.b1_C17.ab1 CHE(LMS) serpentine sunflowe... 54 1e-05 2
(BQ967766) QHB30O14.yg.ab1 QH_ABCDI sunflower RHA801 Heliant... 46 1e-05 3
(FG182158) AGN_PNL205af1_d12.trimmed.seq AGN_PNL Nicotiana t... 50 1e-05 3
(BG592192) EST500034 P. infestans-challenged leaf Solanum tu... 40 1e-05 3
(DV694342) CGN-38806 Leaf Coffea canephora cDNA clone cccl31... 40 1e-05 3
(DV698218) CGN-43827 Seed of Late Development Stage Coffea c... 40 1e-05 3
(CK261412) EST707490 potato abiotic stress cDNA library Sola... 48 1e-05 2
(AM536850) Paracentrotus lividus EST, clone MPMGp1171A0798Q,... 42 1e-05 3
(D22261) Oryza sativa Japonica Group cDNA, partial sequence ... 40 1e-05 3
(EL345260) CCEL1375.b1_M08.ab1 CCE(LMS) endive Cichorium end... 42 1e-05 3
(DQ767687) Brassica napus AtSK12-like protein mRNA, complete... 48 1e-05 3
(EX944523) lk31b05.g7 Gnetum female cone (NYBG) Gnetum gnemo... 54 1e-05 3
(FI058222) CHO_OF6615xd24f1.ab1 CHO_OF6 Nicotiana tabacum ge... 50 1e-05 3
(EH691548) CCIM3728.b1_O20.ab1 CCI(LMS) chicory Cichorium in... 42 1e-05 3
(EE610447) CHWL6043.b1_E24.ab1 CHW(LMS) silverleaf sunflower... 46 1e-05 3
(AC079732) Arabidopsis thaliana chromosome 1 BAC F12K22 geno... 52 1e-05 4
(BX831446) Arabidopsis thaliana Full-length cDNA Complete se... 42 1e-05 3
(DV702271) CGN-48614 Seed of Late Development Stage Coffea c... 40 1e-05 3
(EH696636) CCIM8452.b1_G01.ab1 CCI(LMS) chicory Cichorium in... 42 1e-05 3
(EL361221) CCEM5868.b1_H03.ab1 CCE(LMS) endive Cichorium end... 42 1e-05 3
(CF507555) USDA-FP_123000-056 Immature Ovaries from field-co... 40 2e-05 4
(CS632398) Sequence 164 from Patent WO2007051866. 48 2e-05 3
(AY108486) Zea mays PCO107502 mRNA sequence. 48 2e-05 3
(DW120023) CLRY8643.b1_E02.ab1 CLR(XYZ) lettuce serriola Lac... 44 2e-05 3
(BT035574) Zea mays full-length cDNA clone ZM_BFb0070C15 mRN... 48 2e-05 3
(AR584176) Sequence 9 from patent US 6794561. 48 2e-05 3
(AY813748) Schistosoma japonicum SJCHGC08694 protein mRNA, c... 42 2e-05 4
(CV754511) sjl33-003_F11_sjl33-003F11-T3_091.ab1 SJL Schisto... 42 2e-05 4
(EX533945) NBT100_2007-07-03/NBT100_B08_031_1 Nicotiana bent... 50 2e-05 3
(AM719433) Cucumis melo subsp. melo EST, clone PS_24-B05-M13R. 50 2e-05 3
(DY961065) CLSM11417.b2_A24.ab1 CLS(LMS) lettuce sativa Lact... 64 2e-05 1
(EX852418) CBNC9564.rev CBNC Phycomyces blakesleeanus NRRL15... 64 2e-05 1
(CN186082) UCRCS05_0002F10_r Washington Navel Orange Stored ... 40 2e-05 4
(ES849102) UFL_667_25 Cotton fiber 0-10 day post anthesis Go... 44 2e-05 2
(CV232279) WS0197.B21_B17 PT-DX-N-A-10 Populus trichocarpa c... 42 2e-05 2
(EL448244) CHTM26947.b1_E17.ab1 CHT(LMS) Jerusalem artichoke... 52 2e-05 2
(CV229310) WS01912.B21_O05 PT-DX-N-A-10 Populus trichocarpa ... 42 2e-05 2
(CX185732) B06_45-79_04.ab1 leaf inoculated with Marssonia p... 42 2e-05 2
(CX179398) F02_45-97_12.ab1 leaf inoculated with Marssonia p... 42 2e-05 2
(BW531143) Ciona savignyi cDNA, clone:cslv016p17, 5'end, sin... 42 2e-05 2
(BW532628) Ciona savignyi cDNA, clone:cslv065b13, 5'end, sin... 42 2e-05 2
(BW528833) Ciona savignyi cDNA, clone:cslv007e24, 5'end, sin... 42 2e-05 2
(BW528289) Ciona savignyi cDNA, clone:cslv005g14, 5'end, sin... 42 2e-05 2
(EE087442) S6B00791 Fruits 7-9 mm (VvS6) Vitis vinifera cDNA... 40 2e-05 4
(EF043733) Synthetic construct clone ATCC 10373592 Gsk3 beta... 38 2e-05 4
(EY680994) CS00-C1-650-017-B09-CT.F Sweet orange leaf, young... 40 2e-05 4
(CX293571) C04033B11SK FlavFr1 Citrus clementina cDNA clone ... 40 3e-05 4
(CV524354) Mdlv2_4019c18.y1 Mdlv2 Malus x domestica cDNA clo... 50 3e-05 3
(CB970317) CAB10003_IVa_Fa_G01 Cabernet Sauvignon Flower Pre... 40 3e-05 4
(BF015309) kq62e01.y1 TBN95TM-SSR Strongyloides stercoralis ... 54 3e-05 2
(CF210764) CAB20006_Ia_Fa_H11 Cabernet Sauvignon Flower bloo... 40 3e-05 4
(BE579935) kq34f03.y1 TBN95TM-SSR Strongyloides stercoralis ... 54 3e-05 2
(CX636991) UCRPT02_23H09_g Poncirus trifoliata Roots with Ir... 40 3e-05 4
(EY507297) EST_lsal_am_809917 lsalam whole Lepeophtheirus sa... 36 3e-05 4
(EV023929) BNSCS2CT_UP_112_C01_20APR2007_011 Brassica napus ... 60 4e-05 2
(EY769921) CR05-C1-102-041-G11-CT.F Mandarin leaf, infected ... 40 4e-05 4
(EL463415) CHTS17844.b1_H21.ab1 CHT(LMS) Jerusalem artichoke... 40 4e-05 3
(BC006936) Mus musculus glycogen synthase kinase 3 beta, mRN... 38 4e-05 4
(AR907766) Sequence 7 from patent US 7078510. 38 4e-05 4
(BF219246) 601882096F1 NIH_MGC_57 Homo sapiens cDNA clone IM... 38 4e-05 3
(BG599929) EST504824 cSTS Solanum tuberosum cDNA clone cSTS2... 40 4e-05 3
(DR945781) EST1137320 Aquilegia cDNA library Aquilegia formo... 58 4e-05 2
(AF156099) Mus musculus glycogen synthase kinase 3 beta mRNA... 38 4e-05 4
(CK718640) 18723 Swollen Stolon Solanum tuberosum cDNA, mRNA... 40 4e-05 3
(DT479634) WS02526.BR_H16 PT-MB-N-A-15 Populus trichocarpa c... 46 4e-05 2
(FG165234) AGN_RNC011xm22f1.ab1 AGN_RNC Nicotiana tabacum cD... 56 4e-05 2
(DV692444) CGN-36366 Leaf Coffea canephora cDNA clone cccl25... 40 5e-05 3
(GE577066) CCPU1098.b1_D12.ab1 CCP(UWX) Globe Artichoke Cyna... 52 5e-05 2
(FC773001) CBBN7410.fwd CBBN Lottia gigantea 3,4,5,6.5d Larv... 38 5e-05 4
(FE681429) Pv052A_M13F_E10.ab1 Phaseolus vulgaris cv Early g... 48 5e-05 3
(FE703144) Pv033D_M13R_G04.ab1 Phaseolus vulgaris cv Early g... 48 5e-05 3
(CK274509) EST720587 potato abiotic stress cDNA library Sola... 40 6e-05 3
(EY326471) CAWY11626.fwd CAWY Helobdella robusta Subtracted ... 40 6e-05 3
(FC581414) CAXP15087.fwd CAXP Lottia gigantea from head, foo... 38 6e-05 4
(DY937388) CHPX3699.b1_E14.ab1 CHP(XYZ) plains sunflower Hel... 50 8e-05 2
(DY937506) CHPX3826.b1_D22.ab1 CHP(XYZ) plains sunflower Hel... 50 8e-05 2
(C99904) Arabidopsis thaliana YAC CIC3B1 region specific cDN... 42 8e-05 3
(AY624076) Lytechinus variegatus glycogen synthase kinase-3 ... 42 8e-05 4
(DY305203) KN0AAH2DE12RM1 PhII-III-Vesicles1 Citrus clementi... 40 9e-05 4
(DN348271) LIB3578-012-Q6-K1-E8 LIB3578 Canis lupus familiar... 38 9e-05 3
(DY305471) KN0AAM1AE02RM1 SLH Citrus sinensis cDNA 5', mRNA ... 40 1e-04 4
(EH768720) CNSM15870.b1_L07.ab1 CNS(LMS) yellow starthistle ... 38 1e-04 4
(AW932640) EST358483 tomato fruit mature green, TAMU Solanum... 48 1e-04 2
(DW150986) CLVX2846.b1_L15.ab1 CLV(XYZ) lettuce virosa Lactu... 42 1e-04 4
(CB911495) VVD132A10_372881 An expressed sequence tag databa... 52 1e-04 2
(CV167085) rsmsxl_007344.y1.scf cDNA Library of Salvia milti... 40 1e-04 3
(CK319256) X9P08f07 Populus stem seasonal library Populus de... 46 1e-04 2
(AK170965) Mus musculus NOD-derived CD11c +ve dendritic cell... 38 1e-04 4
(FC682996) CAXX16773.fwd CAXX Lottia gigantea from male gona... 56 1e-04 2
(FG497399) 030415KAWC009125HT (KAWC) Actinidia chinensis - a... 48 1e-04 2
(CB916067) VVD106C03_369795 An expressed sequence tag databa... 52 1e-04 2
(BQ851255) QGB14N08.yg.ab1 QG_ABCDI lettuce salinas Lactuca ... 42 1e-04 3
(FG912326) UCRVU08_CCNS8246_b1 Cowpea IT97K-461-4 Mixed Tiss... 38 1e-04 5
(EX945272) lk41c03.g7 Gnetum female cone (NYBG) Gnetum gnemo... 54 1e-04 2
(CK292091) EST754805 Nicotiana benthamiana mixed tissue cDNA... 50 1e-04 2
(FF398057) MOOFE61TF MOO Vigna unguiculata cDNA 5', mRNA seq... 38 2e-04 3
(CV036084) RTNACL1_44_C05.g1_A029 Roots plus added NaCl Pinu... 46 2e-04 2
(FC734442) CBBG8987.fwd CBBG Lottia gigantea 12,15,18h embry... 56 2e-04 2
(CV471844) 45071.1 Common Scab-Challenged Tubers Solanum tub... 48 2e-04 2
(EX523031) ALF-R-09_2007-07-20_1/ALF(R)-9_I10_020_1 Alfalfa ... 42 2e-04 4
(FC644797) CAXU7374.fwd CAXU Lottia gigantea from female gon... 56 2e-04 2
(GE608605) CCPX5600.b1_O08.ab1 CCP(UWX) Globe Artichoke Cyna... 52 2e-04 2
(FC637143) CAXU2385.fwd CAXU Lottia gigantea from female gon... 56 2e-04 2
(DR953674) EST1145213 Aquilegia cDNA library Aquilegia formo... 58 2e-04 2
(EV525682) RR1AE76TF RR1(CS) Raphanus raphanistrum subsp. ma... 52 2e-04 2
(FH411118) CHO_OF4855xh20r1.ab1 CHO_OF4 Nicotiana tabacum ge... 48 2e-04 2
(EV525800) RR1AG08TF RR1(CS) Raphanus raphanistrum subsp. ma... 52 2e-04 2
(CK286080) EST748802 Nicotiana benthamiana mixed tissue cDNA... 50 2e-04 2
(CK290108) EST752830 Nicotiana benthamiana mixed tissue cDNA... 50 2e-04 2
(CK283056) EST745778 Nicotiana benthamiana mixed tissue cDNA... 50 2e-04 2
(FG860393) UCRVU05_CCNN22980_b1 Cowpea IT84S-2049 Mixed Tiss... 38 2e-04 5
(EE261039) F05_F05ff1c10_pDNRf_501305 Myzus persicae, line F... 48 2e-04 3
(BC060743) Mus musculus glycogen synthase kinase 3 beta, mRN... 38 2e-04 4
(AK154293) Mus musculus NOD-derived CD11c +ve dendritic cell... 38 2e-04 4
(FF396790) MOOFD37TF MOO Vigna unguiculata cDNA 5', mRNA seq... 38 2e-04 5
(AJ806919) Antirrhinum majus EST, clone 018_6_05_e21. 36 2e-04 4
(FF557167) MOPE448TF MOP Vigna unguiculata cDNA 5', mRNA seq... 38 2e-04 5
(BW643572) Dugesia ryukyuensis mRNA, clone: Dr_sW_027_M02, 5... 42 3e-04 2

>(L34674) Dictyostelium discoideum glycogen synthase kinase 3 mRNA,
complete cds.
Length = 1864

Score = 1185 bits (598), Expect(4) = 0.0
Identities = 604/606 (99%)
Strand = Plus / Plus

Query: 471 aaaccaagatcaaataaatttgataaagtaatcattaaatcaaatggagtttgttatata 530
Sbjct: 496 aaaccaagatcaaataaatttgataaagtaatcattaaatcaaatggagtttgttatata 555

Query: 531 acagagggggtaattggaaatggctcatttggtgtcgtcactcaagcaattgtggctgat 590
Sbjct: 556 acagagggggtaattggaaatggctcatttggtgtcgtcactcaagcaattgtggctgat 615

Query: 591 accaaagaggttgtagcaataaaaaaggttttacaagaccaaagatacaagaatcgagaa 650
Sbjct: 616 accaaagaggttgtagcaataaaaaaggttttacaagaccaaagatacaagaatcgagaa 675

Query: 651 ttacaaatcatgaagatgttaaatcatataaatatagtttcattaaaaaatagtttctac 710
Sbjct: 676 ttacaaatcatgaagatgttaaatcatataaatatagtttcattaaaaaatagtttctac 735

Query: 711 acatcagataatgatgaagtttatttaaatttagtattggaatatgtgccagatacagtt 770
Sbjct: 736 acatcagataatgatgaagtttatttaaatttagtattggaatatgtgccagatacagtt 795

Query: 771 tacagagtttcaagacactatagtatgtctaaacaacctgttccaaacatttttgtaaag 830
Sbjct: 796 tacagagtttcaagacactatagtatgtctaaacaacctgttccaaacatttttgtaaag 855

Query: 831 ttatatatatatcaattgtgtagatcaataaactacattcattcacttggaatttgtcat 890
Sbjct: 856 ttatatatatatcaattgtgtagatcaataaactacattcattcacttggaatttgtcat 915

Query: 891 agagatattaaacctcaaaatttattgttggatacatcaaccagtacattaaaactttgc 950
Sbjct: 916 agagatattaaacctcaaaatttattgttggatacatcaaccagtacattaaaactttgc 975

Query: 951 gattttggaagtgcaaagatattaattaaaggagaaactaatgtttcttatatttgttca 1010
Sbjct: 976 gattttggaagtgcaaagatattaattaaaggagaaactaatgtttcttatatttgttca 1035

Query: 1011 agacattatcgtgcaccagaattaatttttggatcaacaaactatactacaacttatgat 1070
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 1036 agacattatcgtgcaccagaattaatttttggatcaacaaactatactacaactattgat 1095

Query: 1071 gtttgg 1076
Sbjct: 1096 gtttgg 1101

Score = 1128 bits (569), Expect(4) = 0.0
Identities = 569/569 (100%)
Strand = Plus / Plus

Query: 1122 gttattccctggtgagaatggtattgaccaattggtagagattataaaggtattgggtac 1181
Sbjct: 1143 gttattccctggtgagaatggtattgaccaattggtagagattataaaggtattgggtac 1202

Query: 1182 accaaccaaagaacaaattcatgcaatgaatccatattatacctcatttaaattcccaga 1241
Sbjct: 1203 accaaccaaagaacaaattcatgcaatgaatccatattatacctcatttaaattcccaga 1262

Query: 1242 gatcaaagcaaacccatggccaagagtattcaaagctaaggatgtaccggccgaatcaat 1301
Sbjct: 1263 gatcaaagcaaacccatggccaagagtattcaaagctaaggatgtaccggccgaatcaat 1322

Query: 1302 tgatttaatctcaaaaatcttactttatgatccatcctcaagattaaagccagttgaaat 1361
Sbjct: 1323 tgatttaatctcaaaaatcttactttatgatccatcctcaagattaaagccagttgaaat 1382

Query: 1362 ttgtgcacatccattctttgatgaattaagagatccaaagacatgtcttccagatggtaa 1421
Sbjct: 1383 ttgtgcacatccattctttgatgaattaagagatccaaagacatgtcttccagatggtaa 1442

Query: 1422 acctttaccacccctcttcaactttacaatcgcagaacaaacttcaatcggtccaaaact 1481
Sbjct: 1443 acctttaccacccctcttcaactttacaatcgcagaacaaacttcaatcggtccaaaact 1502

Query: 1482 agccaaaacattaattccatcacatgctatgaatcaaattgaattgccatcacctttatt 1541
Sbjct: 1503 agccaaaacattaattccatcacatgctatgaatcaaattgaattgccatcacctttatt 1562

Query: 1542 cccaaatttggcaatctcttcttctaatcaatcctcctcttcaaattcaaatgcaaatgt 1601
Sbjct: 1563 cccaaatttggcaatctcttcttctaatcaatcctcctcttcaaattcaaatgcaaatgt 1622

Query: 1602 gtcatcaaatttaaattctcattctgcttcaccttcaactacctcctcctcttcttctac 1661
Sbjct: 1623 gtcatcaaatttaaattctcattctgcttcaccttcaactacctcctcctcttcttctac 1682

Query: 1662 tccaaattcaattcctgttcaatcacctt 1690
Sbjct: 1683 tccaaattcaattcctgttcaatcacctt 1711

Score = 157 bits (79), Expect(4) = 0.0
Identities = 79/79 (100%)
Strand = Plus / Plus

Query: 362 gagttcaaaggatcagatattggagaaagataaaaaggagacagatgataatggcaataa 421
Sbjct: 387 gagttcaaaggatcagatattggagaaagataaaaaggagacagatgataatggcaataa 446

Query: 422 aaagacaacaacaacaact 440
Sbjct: 447 aaagacaacaacaacaact 465

Score = 73.8 bits (37), Expect(4) = 0.0
Identities = 37/37 (100%)
Strand = Plus / Plus

Query: 1085 aggatgtgttttggcagaattattattgggtcaaccg 1121
Sbjct: 1107 aggatgtgttttggcagaattattattgggtcaaccg 1143

Score = 67.9 bits (34), Expect(3) = 4e-11
Identities = 34/34 (100%)
Strand = Plus / Plus

Query: 1756 tcaaatcattaaaactataaacctctccaataca 1789
Sbjct: 1777 tcaaatcattaaaactataaacctctccaataca 1810

Score = 36.2 bits (18), Expect(3) = 4e-11
Identities = 18/18 (100%)
Strand = Plus / Plus

Query: 262 agaatagataacatcacc 279
Sbjct: 286 agaatagataacatcacc 303

Score = 30.2 bits (15), Expect(3) = 4e-11
Identities = 15/15 (100%)
Strand = Plus / Plus

Query: 426 acaacaacaacaact 440
Sbjct: 1759 acaacaacaacaact 1773

Lambda K H
1.37 0.711 1.31

Matrix: blastn matrix:1 -3
Number of Sequences: 98226423
Number of Hits to DB: 2,052,570,061
Number of extensions: 162754028
Number of successful extensions: 13363543
Number of sequences better than 10.0: 2207
Length of query: 1789
Length of database: 98,766,808,389
Length adjustment: 24
Effective length of query: 1765
Effective length of database: 96,409,374,237
Effective search space: 170162545528305
Effective search space used: 170162545528305
X1: 11 (21.8 bits)
S2: 22 (44.1 bits)

protein update 2009. 7.20
Homology vs Protein
Query= Contig-U16068-1 (Contig-U16068-1Q) /CSM_Contig/Contig-U16068-1Q.Seq.d
(1789 letters)

Database: nrp_B
3,236,559 sequences; 1,051,180,864 total letters


Score E
Sequences producing significant alignments: (bits) Value

A55476(A55476)protein kinase (EC gskA - slime mold (D... 436 0.0
EF085206_1(EF085206|pid:none) Picea sitchensis clone WS02728_K01... 270 e-116
AC096856_19(AC096856|pid:none) Oryza sativa chromosome 3 BAC OSJ... 268 e-115
AB032265_1(AB032265|pid:none) Danio rerio mRNA for glycogen synt... 273 e-115
EF677494_1(EF677494|pid:none) Picea sitchensis clone WS02769_M19... 265 e-115
EF142066_1(EF142066|pid:none) Rhipicephalus microplus glycogen s... 280 e-115
AY339070_1(AY339070|pid:none) Physcomitrella patens shaggy-relat... 270 e-114
CR812943_7(CR812943|pid:none) Zebrafish DNA sequence from clone ... 271 e-114
EU586114_1(EU586114|pid:none) Sus scrofa glycogen synthase kinas... 273 e-114
EU239382_1(EU239382|pid:none) Ovis aries glycogen synthase kinas... 273 e-114
EU939764_1(EU939764|pid:none) Saccoglossus kowalevskii glycogen ... 273 e-114
AY339069_1(AY339069|pid:none) Physcomitrella patens shaggy-relat... 267 e-114
AY621077_1(AY621077|pid:none) Chlamydomonas reinhardtii strain C... 279 e-113
AF432225_1(AF432225|pid:none) Medicago sativa GSK-3-like protein... 267 e-113
AC140549_2(AC140549|pid:none) Medicago truncatula clone mth2-28o... 267 e-113
L33801_1(L33801|pid:none) Human protein kinase mRNA, complete cd... 273 e-113
(Q5YJC2) RecName: Full=Glycogen synthase kinase-3 beta; ... 270 e-113
(Q39019) RecName: Full=Shaggy-related protein kinase kappa; ... 268 e-113
T03601(T03601) shaggy protein kinase (EC 2.7.1.-) 6 - common tob... 262 e-113
AY339066_1(AY339066|pid:none) Physcomitrella patens shaggy-relat... 268 e-113
AY624076_1(AY624076|pid:none) Lytechinus variegatus glycogen syn... 274 e-113
(Q2NL51) RecName: Full=Glycogen synthase kinase-3 alpha; ... 268 e-113
S51105(S51105) shaggy protein kinase 4 (EC 2.7.1.-) - garden pet... 265 e-113
AB172147_1(AB172147|pid:none) Macaca fascicularis brain cDNA clo... 270 e-112
CR749620_1(CR749620|pid:none) Homo sapiens mRNA; cDNA DKFZp686D0... 270 e-112
AJ224163_1(AJ224163|pid:none) Nicotiana tabacum mRNA for shaggy-... 260 e-112
(Q9FVS6) RecName: Full=Shaggy-related protein kinase delta; ... 265 e-112
BT068017_1(BT068017|pid:none) Zea mays full-length cDNA clone ZM... 260 e-112
AJ222641_1(AJ222641|pid:none) Paracentrotus lividus (sea urchin)... 275 e-112
BX004874_1(BX004874|pid:none) Zebrafish DNA sequence from clone ... 263 e-112
AY335634_1(AY335634|pid:none) Synthetic construct Homo sapiens g... 273 e-112
AB281487_1(AB281487|pid:none) Triticum aestivum TaSK5 mRNA for S... 266 e-111
AY722707_1(AY722707|pid:none) Zea mays clone ASK1 putative salt-... 258 e-111
AC148764_2(AC148764|pid:none) Medicago truncatula clone mth2-30o... 267 e-111
S51106(S51106)shaggy protein kinase 6 (EC 2.7.1.-) - garden petu... 262 e-110
AC138015_2(AC138015|pid:none) Medicago truncatula clone mth2-34m... 258 e-110
S37642(S37642) protein kinase MSK-3 (EC 2.7.1.-) [similarity] - ... 266 e-110
AB059621_1(AB059621|pid:none) Oryza sativa OSKgamma mRNA for sha... 266 e-110
EF147565_1(EF147565|pid:none) Populus trichocarpa clone WS0123_H... 262 e-110
EU961156_1(EU961156|pid:none) Zea mays clone 232986 glycogen syn... 263 e-110
DQ402057_1(DQ402057|pid:none) Schmidtea mediterranea glycogen sy... 267 e-110
BC160741_1(BC160741|pid:none) Xenopus laevis cDNA clone IMAGE:83... 261 e-110
EF085120_1(EF085120|pid:none) Picea sitchensis clone WS0274_M10 ... 258 e-110
BC161382_1(BC161382|pid:none) Xenopus tropicalis glycogen syntha... 260 e-110
EU965735_1(EU965735|pid:none) Zea mays clone 288381 glycogen syn... 263 e-110
(Q9U094) RecName: Full=Protein kinase shaggy; EC=2.7.11... 265 e-110
AE014298_449(AE014298|pid:none) Drosophila melanogaster chromoso... 265 e-110
AL024485_1(AL024485|pid:none) Drosophila melanogaster cosmid clo... 265 e-110
S10932(S10932) probable protein kinase zeste-white3 (EC 2.7.1.-)... 265 e-110
AE014298_451(AE014298|pid:none) Drosophila melanogaster chromoso... 265 e-110
AE014298_440(AE014298|pid:none) Drosophila melanogaster chromoso... 265 e-110
AE014298_442(AE014298|pid:none) Drosophila melanogaster chromoso... 265 e-110
AY119664_1(AY119664|pid:none) Drosophila melanogaster SD09379 fu... 265 e-110
AE014298_448(AE014298|pid:none) Drosophila melanogaster chromoso... 265 e-110
(P51137) RecName: Full=Glycogen synthase kinase-3 homolog MsK-1;... 265 e-109
DQ364438_1(DQ364438|pid:none) Aegilops tauschii GSK-like kinase ... 263 e-109
DQ252508_1(DQ252508|pid:none) Solanum tuberosum clone 086D08 Ser... 264 e-109
EU935859_1(EU935859|pid:none) Euglena gracilis protein kinase A ... 261 e-109
AJ002315_1(AJ002315|pid:none) Nicotiana tabacum mRNA for shaggy-... 256 e-109
AB181914_1(AB181914|pid:none) Dugesia japonica Dj0167HH mRNA for... 268 e-109
(P43289) RecName: Full=Shaggy-related protein kinase gamma; ... 264 e-109
AY085752_1(AY085752|pid:none) Arabidopsis thaliana clone 17739 m... 264 e-109
AC079029_17(AC079029|pid:none) Oryza sativa chromosome 10 BAC OS... 253 e-109
EU374723_1(EU374723|pid:none) Clytia hemisphaerica glycogen synt... 264 e-109
DQ678924_1(DQ678924|pid:none) Triticum aestivum GSK-like kinase ... 264 e-109
CP001329_591(CP001329|pid:none) Micromonas sp. RCC299 chromosome... 261 e-109
BT035574_1(BT035574|pid:none) Zea mays full-length cDNA clone ZM... 260 e-109
DQ678923_1(DQ678923|pid:none) Triticum aestivum GSK-like kinase ... 261 e-109
(P43288) RecName: Full=Shaggy-related protein kinase alpha; ... 263 e-109
DQ678926_1(DQ678926|pid:none) Aegilops speltoides GSK-like kinas... 264 e-109
DQ678922_1(DQ678922|pid:none) Triticum aestivum GSK-like kinase ... 261 e-109
DQ364437_1(DQ364437|pid:none) Aegilops speltoides GSK-like kinas... 264 e-109
(Q39011) RecName: Full=Shaggy-related protein kinase eta; ... 254 e-109
AK318990_1(AK318990|pid:none) Arabidopsis thaliana AT4G18710 mRN... 254 e-109
AJ002314_1(AJ002314|pid:none) Nicotiana tabacum mRNA for shaggy-... 259 e-108
EF637040_1(EF637040|pid:none) Oryza sativa (japonica cultivar-gr... 253 e-108
AY087542_1(AY087542|pid:none) Arabidopsis thaliana clone 36479 m... 256 e-108
X70862_1(X70862|pid:none) D.melanogaster mRNA for sgg protein ki... 260 e-108
EU961751_1(EU961751|pid:none) Zea mays clone 238059 shaggy-relat... 257 e-108
EF144894_1(EF144894|pid:none) Populus trichocarpa clone WS01119_... 265 e-108
AC124961_2(AC124961|pid:none) Medicago truncatula clone mth2-18l... 254 e-108
AC087552_1(AC087552|pid:none) Oryza sativa (japonica cultivar-gr... 260 e-108
DQ060684_1(DQ060684|pid:none) Oryza sativa (japonica cultivar-gr... 260 e-108
(Q40518) RecName: Full=Shaggy-related protein kinase NtK-1; ... 261 e-108
AP001551_21(AP001551|pid:none) Oryza sativa Japonica Group genom... 258 e-108
AP003991_7(AP003991|pid:none) Oryza sativa Japonica Group genomi... 259 e-108
AY075699_1(AY075699|pid:none) Arabidopsis thaliana AT4g18710/F28... 254 e-108
(Q39012) RecName: Full=Shaggy-related protein kinase iota; ... 256 e-108
T03777(T03777) probable shaggy-like protein kinase etha (EC 2.7.... 259 e-108
DQ364436_1(DQ364436|pid:none) Triticum monococcum GSK-like kinas... 261 e-107
AB032264_1(AB032264|pid:none) Danio rerio mRNA for glycogen synt... 261 e-107
BT052511_1(BT052511|pid:none) Medicago truncatula clone MTYFD_FE... 266 e-107
(O23145) RecName: Full=Shaggy-related protein kinase beta; ... 260 e-107
AK316804_1(AK316804|pid:none) Arabidopsis thaliana AT1G06390 mRN... 256 e-107
S41596(S41596;S26627) protein kinase ASK-alpha (EC 2.7.1.-) [sim... 263 e-107
EU964612_1(EU964612|pid:none) Zea mays clone 280335 shaggy-relat... 258 e-107
AK120194_1(AK120194|pid:none) Oryza sativa Japonica Group cDNA c... 258 e-107
BT034490_1(BT034490|pid:none) Zea mays full-length cDNA clone ZM... 258 e-107
AC104280_4(AC104280|pid:none) Oryza sativa (japonica cultivar-gr... 255 e-107
BT055268_1(BT055268|pid:none) Zea mays full-length cDNA clone ZM... 252 e-106
AJ000732_1(AJ000732|pid:none) Arabidopsis thaliana ASKalpha gene. 263 e-106
AF159950_1(AF159950|pid:none) Caenorhabditis elegans GSK-3 (gsk-... 270 e-106
(A8X5H5) RecName: Full=Glycogen synthase kinase-3; EC=2... 270 e-105
FN357304_19(FN357304|pid:none) Schistosoma mansoni genome sequen... 261 e-105
BT035383_1(BT035383|pid:none) Zea mays full-length cDNA clone ZM... 253 e-105
AF007270_1(AF007270|pid:none) Arabidopsis thaliana BAC F2P16, co... 253 e-104
AJ784431_1(AJ784431|pid:none) Suberites domuncula mRNA for glyco... 258 e-103
AM118080_128(AM118080|pid:none) Ustilago hordei mating type regi... 254 e-103
AM920427_455(AM920427|pid:none) Penicillium chrysogenum Wisconsi... 254 e-103
AJ131048_1(AJ131048|pid:none) Cicer arietinum mRNA for protein k... 239 e-102
AM270329_3(AM270329|pid:none) Aspergillus niger contig An15c0020... 249 e-101
AP007164_22(AP007164|pid:none) Aspergillus oryzae RIB40 genomic ... 249 e-101
AL451015_6(AL451015|pid:none) Neurospora crassa DNA linkage grou... 244 e-100
AM486958_1(AM486958|pid:none) Vitis vinifera contig VV78X005374.... 236 e-100
DQ443471_1(DQ443471|pid:none) Triticum monococcum subsp. aegilop... 263 2e-99
AK317697_1(AK317697|pid:none) Arabidopsis thaliana AT4G18710 mRN... 222 4e-99
DQ168585_1(DQ168585|pid:none) Magnaporthe grisea glycogen syntha... 245 3e-97
BT051791_1(BT051791|pid:none) Medicago truncatula clone MTYF5_F6... 229 1e-96
BT072831_1(BT072831|pid:none) Drosophila melanogaster MIP03616 f... 204 2e-91
AE014298_452(AE014298|pid:none) Drosophila melanogaster chromoso... 204 2e-91
AK102400_1(AK102400|pid:none) Oryza sativa Japonica Group cDNA c... 202 2e-90
EF677283_1(EF677283|pid:none) Picea sitchensis clone WS02764_L14... 262 6e-90
T18457(T18457)glycogen synthase kinase homolog - malaria parasit... 240 4e-89
AL008970_22(AL008970|pid:none) Plasmodium falciparum MAL3P4. &A... 240 4e-89
EU964780_1(EU964780|pid:none) Zea mays clone 281495 unknown mRNA. 196 4e-89
FN392319_1150(FN392319|pid:none) Pichia pastoris GS115 chromosom... 250 5e-89
Y11591_1(Y11591|pid:none) R.communis mRNA for shaggy-like kinase... 186 1e-88
CP000498_567(CP000498|pid:none) Pichia stipitis CBS 6054 chromos... 244 2e-88
CR382138_379(CR382138|pid:none) Debaryomyces hansenii strain CBS... 246 4e-88
FM992689_395(FM992689|pid:none) Candida dubliniensis CD36 chromo... 241 5e-87
BC129215_1(BC129215|pid:none) Danio rerio si:ch211-39e15.2, mRNA... 263 5e-87
AF508265_1(AF508265|pid:none) Pyrocystis lunula shaggy-like kina... 249 9e-86
AM910990_279(AM910990|pid:none) Plasmodium knowlesi strain H chr... 229 1e-85
(Q9URT9) RecName: Full=Protein kinase gsk31; EC=2.7.11.... 223 2e-83
AY557994_1(AY557994|pid:none) Saccharomyces cerevisiae clone FLH... 236 3e-83
CR380958_294(CR380958|pid:none) Candida glabrata strain CBS138 c... 231 3e-81
X54005_1(X54005|pid:none) D.melanogaster ovarian mRNA for zeste-... 265 5e-81
BT052117_1(BT052117|pid:none) Medicago truncatula clone MTYF9_FA... 207 2e-79
FJ168552_8(FJ168552|pid:none) Bodo saltans clone fosmid 45A12, c... 214 3e-79
CU928173_353(CU928173|pid:none) Zygosaccharomyces rouxii strain ... 226 5e-79
CP000882_126(CP000882|pid:none) Hemiselmis andersenii chromosome... 191 1e-77
AE016817_653(AE016817|pid:none) Ashbya gossypii (= Eremothecium ... 227 9e-77
U22348_1(U22348|pid:none) Saccharomyces cerevisiae putative prot... 222 2e-76
DQ406858_1(DQ406858|pid:none) Schmidtea mediterranea glycogen sy... 212 3e-76
AF421214_1(AF421214|pid:none) Colletotrichum gloeosporioides f. ... 177 2e-75
CR382126_733(CR382126|pid:none) Kluyveromyces lactis strain NRRL... 221 1e-73
BC111032_1(BC111032|pid:none) Mus musculus glycogen synthase kin... 165 7e-73
EF676444_1(EF676444|pid:none) Picea sitchensis clone WS02737_N07... 274 9e-72
AB004538_14(AB004538|pid:none) Schizosaccharomyces pombe 39 kb g... 183 2e-71
X87930_1(X87930|pid:none) K.lactis GSK-3 gene. 207 2e-69
CT005257_27(CT005257|pid:none) Leishmania major strain Friedlin,... 196 2e-69
AP008207_609(AP008207|pid:none) Oryza sativa (japonica cultivar-... 159 3e-69
DQ812912_1(DQ812912|pid:none) Leishmania mexicana putative glyco... 198 6e-69
AM494955_28(AM494955|pid:none) Leishmania braziliensis chromosom... 196 6e-69
T04119(T04119) probable serine/threonine protein kinase (EC 2.7.... 162 5e-67
FN357299_37(FN357299|pid:none) Schistosoma mansoni genome sequen... 172 9e-67
DQ307186_1(DQ307186|pid:none) Glossina morsitans morsitans clone... 249 2e-64
BT052433_1(BT052433|pid:none) Medicago truncatula clone MTYFD_FE... 241 5e-62
FN357478_19(FN357478|pid:none) Schistosoma mansoni genome sequen... 157 6e-57
CR380951_64(CR380951|pid:none) Candida glabrata strain CBS138 ch... 167 7e-55
CU928175_107(CU928175|pid:none) Zygosaccharomyces rouxii strain ... 167 2e-54
CU928170_793(CU928170|pid:none) Kluyveromyces thermotolerans str... 167 2e-54
(P21965) RecName: Full=Protein kinase MCK1; EC= 166 1e-53
CR382137_213(CR382137|pid:none) Debaryomyces hansenii strain CBS... 164 3e-52
DQ406859_1(DQ406859|pid:none) Schmidtea mediterranea glycogen sy... 161 5e-52
(Q55C57) RecName: Full=Probable serine/threonine-protein kinase ... 161 3e-50
FN392322_851(FN392322|pid:none) Pichia pastoris GS115 chromosome... 151 1e-48
EF474462_1(EF474462|pid:none) Girardia tigrina glycogen synthase... 139 4e-45
(Q12222) RecName: Full=Probable serine/threonine-protein kinase ... 144 1e-42
AY961950_1(AY961950|pid:none) Picea abies shaggy-related protein... 167 4e-42
AK318670_1(AK318670|pid:none) Arabidopsis thaliana AT1G09840 mRN... 166 8e-40
AY888005_1(AY888005|pid:none) Astragalus membranaceus clone AM77... 156 2e-39
AB195231_1(AB195231|pid:none) Paramecium caudatum pcstk-1 mRNA f... 125 4e-38
AC159413_27(AC159413|pid:none) Trypanosoma brucei chromosome 7 c... 118 2e-37
DQ508116_1(DQ508116|pid:none) Synthetic construct double HA-tagg... 113 2e-35
AJ634003_1(AJ634003|pid:none) Schedonorus arundinaceus mRNA for ... 116 3e-34
AX399975_1(AX399975|pid:none) Sequence 146 from Patent WO0218424... 117 8e-34
(Q4PC06) RecName: Full=Mitogen-activated protein kinase HOG1; ... 114 8e-34
DQ508112_1(DQ508112|pid:none) Synthetic construct double HA-tagg... 113 2e-33
(Q39026) RecName: Full=Mitogen-activated protein kinase 6; ... 113 2e-33
(Q40517) RecName: Full=Mitogen-activated protein kinase homolog ... 111 2e-33
DQ826424_1(DQ826424|pid:none) Oryza sativa (indica cultivar-grou... 116 4e-33
BX936452_3(BX936452|pid:none) Zebrafish DNA sequence from clone ... 117 5e-33
U22890_1(U22890|pid:none) Xenopus laevis glycogen synthase kinas... 145 6e-33
(Q6C4M9) RecName: Full=Mitogen-activated protein kinase HOG1; ... 112 6e-33
(A1CPG7) RecName: Full=Mitogen-activated protein kinase hog1; ... 114 8e-33
(P40417) RecName: Full=Mitogen-activated protein kinase ERK-A; ... 107 1e-32
A46036(A46036) extracellular signal-regulated kinase (EC 2.7.1.-... 107 1e-32
EF156759_1(EF156759|pid:none) Catharanthus roseus putative MAPK2... 115 1e-32
BC147941_1(BC147941|pid:none) Bos taurus cyclin-dependent kinase... 118 1e-32
EU625288_1(EU625288|pid:none) Kluyveromyces marxianus strain NBR... 112 1e-32
(Q92207) RecName: Full=Mitogen-activated protein kinase HOG1; ... 114 1e-32
D14714_1(D14714|pid:none) Arabidopsis thaliana mRNA for ATMPK2, ... 113 1e-32
AJ784996_1(AJ784996|pid:none) Papaver rhoeas mRNA for putative M... 112 1e-32
DQ508108_1(DQ508108|pid:none) Synthetic construct double HA-tagg... 114 2e-32
AB277827_1(AB277827|pid:none) Sarcophaga crassipalpis erk mRNA f... 103 2e-32
(Q39022) RecName: Full=Mitogen-activated protein kinase 2; ... 114 2e-32
EU499337_1(EU499337|pid:none) Carassius auratus extracellular si... 108 2e-32
(Q9UV51) RecName: Full=Mitogen-activated protein kinase HOG1; ... 114 2e-32
AF329506_1(AF329506|pid:none) Glycine max mitogen-activated prot... 112 2e-32
(Q40884) RecName: Full=Mitogen-activated protein kinase homolog ... 108 2e-32
FM992689_307(FM992689|pid:none) Candida dubliniensis CD36 chromo... 115 2e-32
EF121308_1(EF121308|pid:none) Nicotiana attenuata mitogen-activa... 111 2e-32
(Q6CJA8) RecName: Full=Mitogen-activated protein kinase HOG1; ... 112 3e-32
AY426249_1(AY426249|pid:none) Tetrahymena thermophila putative M... 108 3e-32
EF185418_1(EF185418|pid:none) Citrus sinensis mitogen-activated ... 112 3e-32
AY145443_1(AY145443|pid:none) Strongylocentrotus purpuratus MAP ... 117 3e-32
(P0C431) RecName: Full=Mitogen-activated protein kinase HOG1; ... 113 3e-32
U53878_7(U53878|pid:none) Saccharomyces cerevisiae chromosome XI... 111 4e-32
(P32485) RecName: Full=Mitogen-activated protein kinase HOG1; ... 111 4e-32
L06279_1(L06279|pid:none) Saccharomyces cerevisiae osmosensing p... 111 4e-32
DQ078119_1(DQ078119|pid:none) Rheum australe mitogen-activated p... 114 4e-32
(A1CAF0) RecName: Full=Mitogen-activated protein kinase mpkC; ... 114 4e-32
(Q9UV50) RecName: Full=Mitogen-activated protein kinase HOG1; ... 112 5e-32
(A3LN91) RecName: Full=Mitogen-activated protein kinase HOG1; ... 114 5e-32
(Q875L0) RecName: Full=Mitogen-activated protein kinase HOG1; ... 114 5e-32
(Q2WFL5) RecName: Full=Mitogen-activated protein kinase HOG1; ... 115 5e-32
(Q6AXJ9) RecName: Full=Cyclin-dependent kinase-like 1; ... 114 5e-32
EU959126_1(EU959126|pid:none) Zea mays clone 210514 cell divisio... 99 5e-32
AE016820_416(AE016820|pid:none) Ashbya gossypii (= Eremothecium ... 113 7e-32
(Q750A9) RecName: Full=Mitogen-activated protein kinase HOG1; ... 113 7e-32
AF433655_1(AF433655|pid:none) Paralichthys olivaceus mitogen-act... 107 7e-32
DQ923592_1(DQ923592|pid:none) Meloidogyne incognita mitogen-acti... 105 7e-32
AF185278_1(AF185278|pid:none) Debaryomyces hansenii Hog1p (HOG1)... 112 7e-32
AC124964_11(AC124964|pid:none) Medicago truncatula clone mth2-27... 111 7e-32
AM236754_1(AM236754|pid:none) Festuca arundinacea mRNA for mitog... 115 7e-32
BT038103_1(BT038103|pid:none) Zea mays full-length cDNA clone ZM... 112 7e-32
DQ295030_1(DQ295030|pid:none) Zea mays putative MAPK mRNA, compl... 112 7e-32
EU675864_1(EU675864|pid:none) Oryza sativa Indica Group mitogen ... 112 7e-32
(Q6Z437) RecName: Full=Mitogen-activated protein kinase 3; ... 112 7e-32
BC154001_1(BC154001|pid:none) Danio rerio zgc:171775, mRNA (cDNA... 110 7e-32
(Q1KTF2) RecName: Full=Mitogen-activated protein kinase Hog1; ... 114 7e-32
EF467357_1(EF467357|pid:none) Fusarium proliferatum HOG1 type MA... 113 7e-32
(Q75Q66) RecName: Full=Mitogen-activated protein kinase HOG1; ... 113 7e-32
CR940347_554(CR940347|pid:none) Theileria annulata strain Ankara... 112 9e-32
AF149424_1(AF149424|pid:none) Ipomoea batatas MAP kinase mRNA, c... 114 9e-32
(Q8NJT7) RecName: Full=Mitogen-activated protein kinase HOG1; ... 114 9e-32
AB029067_1(AB029067|pid:none) Mus musculus Kkm mRNA for Ser/Thr ... 112 9e-32
(Q40532) RecName: Full=Mitogen-activated protein kinase homolog ... 112 1e-31
DQ229078_1(DQ229078|pid:none) Nicotiana tabacum mitogen-activate... 112 1e-31
AJ536587_1(AJ536587|pid:none) Marthasterias glacialis partial mR... 107 1e-31
(Q6XKY3) RecName: Full=Mitogen-activated protein kinase hog1; ... 112 1e-31
AM270168_141(AM270168|pid:none) Aspergillus niger contig An08c01... 111 1e-31
EU130900_1(EU130900|pid:none) Zea mays ABA stimulation MAP kinas... 114 1e-31
BT038543_1(BT038543|pid:none) Zea mays full-length cDNA clone ZM... 114 1e-31
(A2QRF6) RecName: Full=Mitogen-activated protein kinase hog1; ... 111 1e-31
BT070328_1(BT070328|pid:none) Picea sitchensis clone WS02720_C19... 116 2e-31
DQ132852_1(DQ132852|pid:none) Gossypium hirsutum mitogen-activat... 111 2e-31
(Q09892) RecName: Full=Mitogen-activated protein kinase sty1; ... 110 2e-31
AY144442_19(AY144442|pid:none) Sorghum bicolor BAC 95A23/98N8.1 ... 96 2e-31
(Q8L4P8) RecName: Full=Cyclin-dependent kinase B1-1; Sh... 97 2e-31
(A2QN07) RecName: Full=Mitogen-activated protein kinase mpkC; ... 110 3e-31
AF242308_1(AF242308|pid:none) Euphorbia esula mitogen-activated ... 112 3e-31
CU633897_281(CU633897|pid:none) Podospora anserina genomic DNA c... 112 3e-31
BC111325_1(BC111325|pid:none) Bos taurus cyclin-dependent kinase... 119 3e-31
AY383681_1(AY383681|pid:none) Rattus norvegicus LRRGT00026 mRNA,... 112 3e-31
(Q5XIT0) RecName: Full=Cyclin-dependent kinase-like 2; ... 112 3e-31
AY335595_1(AY335595|pid:none) Synthetic construct Homo sapiens m... 105 3e-31
(P27361) RecName: Full=Mitogen-activated protein kinase 3; ... 105 3e-31
M84490_1(M84490|pid:none) Human extracellular signal-regulated k... 105 3e-31
(Q1DUU8) RecName: Full=Mitogen-activated protein kinase HOG1; ... 115 3e-31
CP001574_516(CP001574|pid:none) Micromonas sp. RCC299 chromosome... 112 3e-31
AY033607_1(AY033607|pid:none) Homo sapiens extracellular signal-... 105 3e-31
AX040962_1(AX040962|pid:none) Sequence 9 from Patent WO0065040. ... 106 3e-31
U18365_1(U18365|pid:none) Brassica napus cyclin dependent protei... 107 3e-31
AY261512_1(AY261512|pid:none) Lycopersicon esculentum mitogen-ac... 111 4e-31
AB062138_1(AB062138|pid:none) Solanum tuberosum StMPK1 mRNA for ... 110 4e-31
AB373026_1(AB373026|pid:none) Nicotiana benthamiana NbNTF4 mRNA ... 110 4e-31
AX040958_1(AX040958|pid:none) Sequence 5 from Patent WO0065040. 107 4e-31
CU633987_1(CU633987|pid:none) Zebrafish DNA sequence from clone ... 108 6e-31
(Q6FIU2) RecName: Full=Mitogen-activated protein kinase HOG1; ... 109 6e-31
AY261513_1(AY261513|pid:none) Lycopersicon esculentum mitogen-ac... 110 6e-31
DQ508107_1(DQ508107|pid:none) Synthetic construct double HA-tagg... 114 6e-31
(Q39021) RecName: Full=Mitogen-activated protein kinase 1; ... 114 6e-31
(Q56R42) RecName: Full=Mitogen-activated protein kinase HOG1; ... 112 6e-31
AX040966_1(AX040966|pid:none) Sequence 13 from Patent WO0065040. 101 6e-31
EU965114_1(EU965114|pid:none) Zea mays clone 283922 MPK6 - putat... 111 7e-31
BT058458_1(BT058458|pid:none) Salmo salar clone Contig995 Mitoge... 101 7e-31
T09622(T09622) protein kinase MMK4 (EC 2.7.1.-), cold- and droug... 109 7e-31
AC145164_3(AC145164|pid:none) Medicago truncatula clone mth2-27j... 109 7e-31
AK317230_1(AK317230|pid:none) Arabidopsis thaliana AT1G10210 mRN... 114 7e-31
CP000584_9(CP000584|pid:none) Ostreococcus lucimarinus CCE9901 c... 104 7e-31
AB489227_1(AB489227|pid:none) Danio rerio Cdkl5 mRNA for cyclin ... 108 9e-31
BC162960_1(BC162960|pid:none) Danio rerio zgc:194395, mRNA (cDNA... 108 9e-31
EU887292_1(EU887292|pid:none) Solanum peruvianum mitogen activat... 110 9e-31
EU182580_1(EU182580|pid:none) Arachis hypogaea mitogen-activated... 110 9e-31
(Q0D0P5) RecName: Full=Mitogen-activated protein kinase hog1; ... 111 9e-31
(P29618) RecName: Full=Cyclin-dependent kinase A-1; Sho... 105 1e-30
AC113930_15(AC113930|pid:none) Oryza sativa (japonica cultivar-g... 105 1e-30
A84441_1(A84441|pid:none) Sequence 56 from Patent WO9845704. &A... 103 1e-30
DQ229077_1(DQ229077|pid:none) Nicotiana tabacum mitogen-activate... 110 1e-30
AF247136_1(AF247136|pid:none) Capsicum annuum MAP kinase 2 (MK2)... 109 1e-30
(P21708) RecName: Full=Mitogen-activated protein kinase 3; ... 103 1e-30
S28184(S28184;B40466;A41371)Ca2+/calmodulin-dependent protein ki... 103 1e-30
U12008_1(U12008|pid:none) Rattus norvegicus microtubule-associat... 103 1e-30
AK291845_1(AK291845|pid:none) Homo sapiens cDNA FLJ75738 complet... 107 1e-30
(Q8TGA9) RecName: Full=Mitogen-activated protein kinase HOG1; ... 112 1e-30
(P24100) RecName: Full=Cyclin-dependent kinase A-1; Sho... 106 1e-30
CP001323_931(CP001323|pid:none) Micromonas sp. RCC299 chromosome... 100 2e-30
AY805424_1(AY805424|pid:none) Chorispora bungeana mitogen-activa... 111 2e-30
AF134730_1(AF134730|pid:none) Prunus armeniaca putative mitogen-... 109 2e-30
BC082646_1(BC082646|pid:none) Xenopus laevis hypothetical LOC494... 105 2e-30
AF289467_1(AF289467|pid:none) Nicotiana tabacum cyclin-dependent... 110 2e-30
BT038008_1(BT038008|pid:none) Zea mays full-length cDNA clone ZM... 107 2e-30
EU969498_1(EU969498|pid:none) Zea mays clone 331095 cell divisio... 107 2e-30
AF155236_1(AF155236|pid:none) Rattus norvegicus extracellular si... 102 2e-30
U94192_1(U94192|pid:none) Nicotiana tabacum salicylic acid-activ... 109 2e-30
AB030902_1(AB030902|pid:none) Danio rerio mRNA for ERK1, complet... 103 2e-30
AX048754_1(AX048754|pid:none) Sequence 25 from Patent WO0070059. 112 2e-30
AF247135_1(AF247135|pid:none) Capsicum annuum MAP kinase 1 (MK1)... 109 2e-30
AY261514_1(AY261514|pid:none) Lycopersicon esculentum mitogen-ac... 109 2e-30
EU196042_1(EU196042|pid:none) Epichloe festucae strain Fl1 stres... 113 2e-30
AF289465_1(AF289465|pid:none) Nicotiana tabacum cyclin-dependent... 99 2e-30
DQ364234_1(DQ364234|pid:none) Prunus dulcis cyclin-dependent kin... 106 2e-30
(P23111) RecName: Full=Cell division control protein 2 homolog; ... 105 2e-30
FB667479_1(FB667479|pid:none) Sequence 1 from Patent WO2007141189. 103 2e-30
AB205132_1(AB205132|pid:none) Scutellaria baicalensis cdka2 mRNA... 103 2e-30
AL021687_2(AL021687|pid:none) Arabidopsis thaliana DNA chromosom... 103 2e-30
A84499_1(A84499|pid:none) Sequence 114 from Patent WO9845704. &... 102 3e-30
EU931241_1(EU931241|pid:none) Rheum australe mitogen activated p... 108 3e-30
EU966243_1(EU966243|pid:none) Zea mays clone 292788 MPK3 - putat... 113 3e-30
EU391604_1(EU391604|pid:none) Datura metel mitogen activated pro... 106 3e-30
EU675863_1(EU675863|pid:none) Oryza sativa Indica Group mitogen ... 110 3e-30
AP004885_10(AP004885|pid:none) Oryza sativa Japonica Group genom... 103 3e-30
X61622_1(X61622|pid:none) H.sapiens CDK2 mRNA. 102 3e-30
(P29619) RecName: Full=Cyclin-dependent kinase A-2; Sho... 103 3e-30
(O76039) RecName: Full=Cyclin-dependent kinase-like 5; ... 112 4e-30
(Q3UTQ8) RecName: Full=Cyclin-dependent kinase-like 5; ... 112 4e-30
AK052380_1(AK052380|pid:none) Mus musculus 13 days embryo heart ... 112 4e-30
EU616650_1(EU616650|pid:none) Zea mays ABA stimulation MAP kinas... 110 4e-30
AB006038_1(AB006038|pid:none) Cyprinus carpio cERK1 mRNA for ext... 100 4e-30
D61377_1(D61377|pid:none) Nicotiana tabacum mRNA for WIPK, compl... 109 4e-30
D21839_1(D21839|pid:none) Arabidopsis thaliana mRNA for MAP kina... 110 4e-30
(Q39023) RecName: Full=Mitogen-activated protein kinase 3; ... 110 4e-30
BC013754_1(BC013754|pid:none) Mus musculus mitogen-activated pro... 101 4e-30
AP003349_10(AP003349|pid:none) Oryza sativa Japonica Group genom... 93 4e-30
CU928176_261(CU928176|pid:none) Zygosaccharomyces rouxii strain ... 107 5e-30
AB373025_1(AB373025|pid:none) Nicotiana benthamiana NbSIPK mRNA ... 109 5e-30
AB098730_1(AB098730|pid:none) Nicotiana benthamiana NbSIPK mRNA ... 109 5e-30
(O93982) RecName: Full=Mitogen-activated protein kinase HOG1; ... 107 5e-30
AB098729_1(AB098729|pid:none) Nicotiana benthamiana NbWIPK mRNA ... 109 5e-30
AJ250311_1(AJ250311|pid:none) Oryza sativa mRNA for MAPK2 protei... 112 5e-30
(Q38HL5) RecName: Full=Mitogen-activated protein kinase hog1; ... 106 5e-30
U22891_1(U22891|pid:none) Xenopus laevis glycogen synthase kinas... 135 5e-30
BC159155_1(BC159155|pid:none) Xenopus tropicalis hypothetical pr... 112 6e-30
EF156758_1(EF156758|pid:none) Catharanthus roseus putative MAPK1... 109 6e-30
(Q2U469) RecName: Full=Mitogen-activated protein kinase mpkC; ... 110 6e-30
AJ297917_1(AJ297917|pid:none) Lycopersicon esculentum mRNA for B... 97 6e-30
AF104247_1(AF104247|pid:none) Glycine max mitogen-activated prot... 105 8e-30
(Q54QB1) RecName: Full=Extracellular signal-regulated kinase 2; ... 103 8e-30
AY335777_1(AY335777|pid:none) Synthetic construct Homo sapiens m... 104 8e-30
U92268_1(U92268|pid:none) Homo sapiens mitogen activated protein... 104 8e-30
(Q15759) RecName: Full=Mitogen-activated protein kinase 11; ... 104 8e-30
AY460178_1(AY460178|pid:none) Entamoeba histolytica strain NIH 2... 122 8e-30
AJ297916_1(AJ297916|pid:none) Lycopersicon esculentum mRNA for B... 98 8e-30
(Q63699) RecName: Full=Cell division protein kinase 2; ... 100 8e-30
X62071_1(X62071|pid:none) H.sapiens cdk2 mRNA. 100 8e-30
EU006765_1(EU006765|pid:none) Gossypium hirsutum cultivar des119... 105 8e-30
DQ115400_1(DQ115400|pid:none) Toxoplasma gondii mitogen-activate... 112 1e-29
AB206552_1(AB206552|pid:none) Solanum tuberosum StWIPK mRNA for ... 108 1e-29
DQ826422_1(DQ826422|pid:none) Oryza sativa (indica cultivar-grou... 111 1e-29
(A2XFC8) RecName: Full=Mitogen-activated protein kinase 5; ... 111 1e-29
AF332873_1(AF332873|pid:none) Oryza sativa MAP kinase BIMK1 mRNA... 111 1e-29
DQ118734_1(DQ118734|pid:none) Cucumis sativus cultivar Kfir Tric... 107 1e-29
AY335654_1(AY335654|pid:none) Synthetic construct Homo sapiens c... 100 1e-29
(Q5E9Y0) RecName: Full=Cell division protein kinase 2; ... 100 1e-29
EU675868_1(EU675868|pid:none) Oryza sativa Indica Group mitogen ... 107 1e-29
(Q5ZCI1) RecName: Full=Mitogen-activated protein kinase 10; ... 107 1e-29
DQ508113_1(DQ508113|pid:none) Synthetic construct double HA-tagg... 109 1e-29
(Q39027) RecName: Full=Mitogen-activated protein kinase 7; ... 109 1e-29
(O55076) RecName: Full=Cell division protein kinase 2; ... 100 1e-29
AE014134_998(AE014134|pid:none) Drosophila melanogaster chromoso... 115 2e-29
AY162318_1(AY162318|pid:none) Hypocrea virens MAP kinase TVK1 (t... 108 2e-29
AY675093_1(AY675093|pid:none) Ostreococcus tauri cell cycle depe... 100 2e-29
AJ496622_1(AJ496622|pid:none) Coffea arabica mRNA for cyclin dep... 108 2e-29
AY753214_1(AY753214|pid:none) Saccharum officinarum cell-divisio... 103 2e-29
AM494969_354(AM494969|pid:none) Leishmania braziliensis chromoso... 113 2e-29
BC121410_1(BC121410|pid:none) Xenopus tropicalis mitogen-activat... 96 2e-29
AM502245_10(AM502245|pid:none) Leishmania infantum chromosome 27. 95 2e-29
AM494972_84(AM494972|pid:none) Leishmania braziliensis chromosom... 111 2e-29
BC057211_1(BC057211|pid:none) Mus musculus mitogen-activated pro... 104 2e-29
S79590_1(S79590|pid:none) mo15=putative protein kinase-subunit o... 94 2e-29
(P54685) RecName: Full=Cell division protein kinase 7; ... 94 2e-29
AY307372_1(AY307372|pid:none) Populus tremula x Populus tremuloi... 94 2e-29
AF126147_1(AF126147|pid:none) Paramecium tetraurelia cyclin-depe... 101 2e-29
AY090353_1(AY090353|pid:none) Arabidopsis thaliana AT3g48750/T21... 106 2e-29
FB667495_1(FB667495|pid:none) Sequence 17 from Patent WO20071411... 102 2e-29
BC085415_1(BC085415|pid:none) Danio rerio mitogen-activated prot... 97 4e-29
(Q3TZA2) RecName: Full=Cyclin-dependent kinase-like 4; ... 120 4e-29
BC077412_1(BC077412|pid:none) Xenopus laevis ERK5, mRNA (cDNA cl... 98 5e-29
AB213560_1(AB213560|pid:none) Xenopus laevis mRNA for ERK5, comp... 98 5e-29
DQ152244_1(DQ152244|pid:none) Phytophthora parasitica mitogen-ac... 99 5e-29
EU101715_1(EU101715|pid:none) Triticum aestivum serine/threonine... 100 5e-29
(O59854) RecName: Full=Mitogen-activated protein kinase HOG1; ... 107 5e-29
AF079318_1(AF079318|pid:none) Triticum aestivum MAP kinase homol... 109 5e-29
D21843_1(D21843|pid:none) Arabidopsis thaliana mRNA for MAP kina... 108 5e-29
BC064737_1(BC064737|pid:none) Mus musculus mitogen-activated pro... 103 5e-29
CP000594_67(CP000594|pid:none) Ostreococcus lucimarinus CCE9901 ... 89 5e-29
BC049499_1(BC049499|pid:none) Danio rerio cyclin-dependent kinas... 102 5e-29
AF225919_1(AF225919|pid:none) Homo sapiens intestinal cell kinas... 111 6e-29
(O59853) RecName: Full=Mitogen-activated protein kinase HOG2; ... 107 6e-29
DQ026027_1(DQ026027|pid:none) Leishmania mexicana putative mitog... 101 6e-29
CP000588_41(CP000588|pid:none) Ostreococcus lucimarinus CCE9901 ... 99 6e-29
FM992695_524(FM992695|pid:none) Candida dubliniensis CD36 chromo... 105 6e-29
B56708(B56708) extracellular signal-regulated kinase 5 - human ... 97 8e-29
(Q6Z8C8) RecName: Full=Cyclin-dependent kinase F-4; Sho... 100 8e-29
AB205133_1(AB205133|pid:none) Scutellaria baicalensis cdkb mRNA ... 93 8e-29
(Q5MAI5) RecName: Full=Cyclin-dependent kinase-like 4; ... 116 8e-29
AK295376_1(AK295376|pid:none) Homo sapiens cDNA FLJ60404 partial... 97 1e-28
AF126159_1(AF126159|pid:none) Mus musculus big MAP kinase 1a (BM... 96 1e-28
(A5PKJ4) RecName: Full=Mitogen-activated protein kinase 7; ... 97 1e-28
CP000079_10(CP000079|pid:none) Leishmania major strain Friedlin ... 92 1e-28
(O42376) RecName: Full=Mitogen-activated protein kinase 12; ... 95 1e-28
BC126500_1(BC126500|pid:none) Bos taurus mitogen-activated prote... 100 1e-28
GM754310_1(GM754310|pid:none) Sequence 3 from Patent WO2008116829. 104 1e-28
DQ812906_1(DQ812906|pid:none) Leishmania mexicana putative mitog... 92 2e-28
AX048786_1(AX048786|pid:none) Sequence 57 from Patent WO0070059. 107 2e-28
CP000589_44(CP000589|pid:none) Ostreococcus lucimarinus CCE9901 ... 107 2e-28
BC167997_1(BC167997|pid:none) Xenopus tropicalis mitogen-activat... 100 2e-28
BC075368_1(BC075368|pid:none) Xenopus tropicalis mitogen-activat... 98 2e-28
EF392719_1(EF392719|pid:none) Actinidia chinensis cyclin-depende... 96 2e-28
AY881102_1(AY881102|pid:none) Triticum aestivum putative MAPK pr... 106 2e-28
DQ444321_1(DQ444321|pid:none) Triticum aestivum mitogen-activate... 106 2e-28
DQ322668_1(DQ322668|pid:none) Triticum aestivum mitogen-activate... 106 2e-28
AF508042_1(AF508042|pid:none) Aplysia californica p38 MAP kinase... 102 2e-28
B44349(B44349) protein kinase (EC cdc2-B - African cla... 90 2e-28
(P43450) RecName: Full=Cell division protein kinase 2; ... 99 2e-28
AL590447_128(AL590447|pid:none) chromosome VII of strain GB-M1 o... 129 3e-28
AJ293284_1(AJ293284|pid:none) Leishmania mexicana mexicana MPK6 ... 111 3e-28
AM502251_148(AM502251|pid:none) Leishmania infantum chromosome 33. 100 3e-28
AX803349_1(AX803349|pid:none) Sequence 11 from Patent WO03000901. 95 3e-28
AM392563_1(AM392563|pid:none) Synthetic construct Homo sapiens c... 99 3e-28
BX537897_1(BX537897|pid:none) Homo sapiens mRNA; cDNA DKFZp686O0... 95 3e-28
AB205131_1(AB205131|pid:none) Scutellaria baicalensis cdka1 mRNA... 100 3e-28
AE014187_292(AE014187|pid:none) Plasmodium falciparum 3D7 chromo... 104 4e-28
JC5153(JC5153)mitogen-activated protein kinase (EC 2.7.1.-) - ma... 104 4e-28
U36377_1(U36377|pid:none) Plasmodium falciparum mitogen-activate... 104 4e-28
DQ508126_1(DQ508126|pid:none) Synthetic construct HA-tagged mito... 105 4e-28
(Q9SJG9) RecName: Full=Mitogen-activated protein kinase 20; ... 105 4e-28
D84859(D84859)probable MAP kinase [imported] - Arabidopsis thali... 105 4e-28
DQ322667_1(DQ322667|pid:none) Triticum aestivum mitogen-activate... 108 4e-28
AB038693_1(AB038693|pid:none) Arabidopsis thaliana mRNA for ATMP... 107 4e-28
T23710(T23710)hypothetical protein M04C9.5 - Caenorhabditis eleg... 103 4e-28
Z83731_7(Z83731|pid:none) Caenorhabditis elegans Cosmid M04C9, c... 103 4e-28
AY335734_1(AY335734|pid:none) Synthetic construct Homo sapiens c... 99 4e-28
BT061425_1(BT061425|pid:none) Zea mays full-length cDNA clone ZM... 99 5e-28
AJ307674_1(AJ307674|pid:none) Suberites domuncula p38ge gene for... 95 5e-28
Y18861_1(Y18861|pid:none) Suberites domuncula mRNA for MAP kinase. 95 5e-28
BC005298_1(BC005298|pid:none) Homo sapiens cyclin-dependent kina... 99 5e-28
Y13646_1(Y13646|pid:none) Petunia hybrida mRNA for cyclin depend... 104 5e-28
(Q00526) RecName: Full=Cell division protein kinase 3; ... 97 5e-28
BT086869_1(BT086869|pid:none) Zea mays full-length cDNA clone ZM... 128 6e-28
AX250443_1(AX250443|pid:none) Sequence 49 from Patent WO0168863. 128 6e-28
AM494964_11(AM494964|pid:none) Leishmania braziliensis chromosom... 92 7e-28
(Q9HG11) RecName: Full=Mitogen-activated protein kinase mpkC; ... 110 7e-28
BC106518_1(BC106518|pid:none) Xenopus laevis hypothetical protei... 96 7e-28
FJ210468_1(FJ210468|pid:none) Eriocheir sinensis Cdc2 kinase mRN... 89 7e-28
AB008187_1(AB008187|pid:none) Pisum sativum mRNA for cdc2, compl... 102 7e-28
EU974844_1(EU974844|pid:none) Zea mays clone 459682 MPK17-1 - pu... 105 9e-28
AJ495775_1(AJ495775|pid:none) Hordeum vulgare mRNA for putative ... 104 9e-28
AJ786397_1(AJ786397|pid:none) Festuca arundinacea mRNA for mitog... 104 9e-28
FN357296_61(FN357296|pid:none) Schistosoma mansoni genome sequen... 113 9e-28
Y13120_1(Y13120|pid:none) H.sapiens mRNA for serine/threonine pr... 99 9e-28
EU169386_1(EU169386|pid:none) Glycine max CDC2 mRNA, complete cds. 103 9e-28
Z75661_1(Z75661|pid:none) S.rostrata mRNA for cdc2 kinase-like p... 100 9e-28
AF326965_1(AF326965|pid:none) Trypanosoma brucei putative MAP ki... 119 1e-27
DQ508114_1(DQ508114|pid:none) Synthetic construct double HA-tagg... 106 1e-27
AY425817_1(AY425817|pid:none) Zea mays cultivar WF9 mitogen acti... 107 1e-27
CP001326_470(CP001326|pid:none) Micromonas sp. RCC299 chromosome... 87 1e-27
CR954215_12(CR954215|pid:none) Ostreococcus tauri strain OTTH059... 103 1e-27
(A2Y4B6) RecName: Full=Cyclin-dependent kinase D-1; Sho... 102 1e-27
AY560586_1(AY560586|pid:none) Tetrahymena thermophila mitogen ac... 99 1e-27
AY449462_3(AY449462|pid:none) Oikopleura dioica clone BACOIKO006... 116 1e-27
(Q0J4I1) RecName: Full=Cyclin-dependent kinase B2-1; Sh... 97 1e-27
AF389283_1(AF389283|pid:none) Arabidopsis thaliana At1g76540/F14... 96 1e-27
(Q8LF80) RecName: Full=Cyclin-dependent kinase B2-1; Sh... 96 1e-27
AP004765_12(AP004765|pid:none) Oryza sativa Japonica Group genom... 97 1e-27
(Q38773) RecName: Full=Cell division control protein 2 homolog B... 98 1e-27
AK154185_1(AK154185|pid:none) Mus musculus NOD-derived CD11c +ve... 107 2e-27
(Q62726) RecName: Full=Serine/threonine-protein kinase ICK; ... 107 2e-27
(Q5Z9J0) RecName: Full=Mitogen-activated protein kinase 12; ... 105 2e-27
BT054843_1(BT054843|pid:none) Zea mays full-length cDNA clone ZM... 103 2e-27
DQ322666_1(DQ322666|pid:none) Triticum aestivum mitogen-activate... 108 2e-27
EU779804_1(EU779804|pid:none) Oryza sativa Indica Group cultivar... 106 2e-27
AF194415_1(AF194415|pid:none) Oryza sativa MAP kinase homolog (M... 105 2e-27
AY737714_1(AY737714|pid:none) Brassica napus mitogen-activated p... 104 2e-27
(Q4WUN7) RecName: Full=Mitogen-activated protein kinase mpkC; ... 105 2e-27
DQ078310_1(DQ078310|pid:none) Littorina littorea p38 MAPK mRNA, ... 98 2e-27
S53538(S53538)protein kinase (EC cdc2 homolog - Parame... 98 2e-27
BC061617_1(BC061617|pid:none) Xenopus tropicalis cell division c... 86 2e-27
EF182713_1(EF182713|pid:none) Gallus gallus cyclin dependent kin... 97 2e-27
AF146687_8(AF146687|pid:none) Fugu rubripes U2 small nuclear rib... 98 2e-27
AK074892_1(AK074892|pid:none) Homo sapiens cDNA FLJ90411 fis, cl... 107 2e-27
(Q9JKV2) RecName: Full=Serine/threonine-protein kinase ICK; ... 107 2e-27
CR954208_43(CR954208|pid:none) Ostreococcus tauri strain OTTH059... 96 2e-27
AJ293280_1(AJ293280|pid:none) Leishmania mexicana mexicana MPK2 ... 105 2e-27
BT034478_1(BT034478|pid:none) Zea mays full-length cDNA clone ZM... 99 2e-27
AM393110_1(AM393110|pid:none) Synthetic construct Homo sapiens c... 99 2e-27
BT081803_1(BT081803|pid:none) Rana catesbeiana clone rcat-evr-53... 96 2e-27
AB006033_1(AB006033|pid:none) Allium cepa mRNA for cdc2 kinase, ... 100 2e-27

>A55476(A55476)protein kinase (EC gskA - slime mold
(Dictyostelium discoideum)
Length = 468

Score = 436 bits (1121), Expect(2) = 0.0
Identities = 224/258 (86%), Positives = 226/258 (87%), Gaps = 1/258 (0%)
Frame = +3






Score = 300 bits (769), Expect(2) = 0.0
Identities = 145/145 (100%), Positives = 145/145 (100%)
Frame = +1




Lambda K H
0.318 0.134 0.401

Lambda K H
0.267 0.0410 0.140

Matrix: BLOSUM62
Gap Penalties: Existence: 11, Extension: 1
Number of Sequences: 3236559
Number of Hits to DB: 2,332,472,351
Number of extensions: 45545890
Number of successful extensions: 152309
Number of sequences better than 10.0: 11267
Number of HSP's gapped: 139933
Number of HSP's successfully gapped: 13484
Length of query: 596
Length of database: 1,051,180,864
Length adjustment: 134
Effective length of query: 462
Effective length of database: 617,481,958
Effective search space: 285276664596
Effective search space used: 285276664596
Neighboring words threshold: 12
Window for multiple hits: 40
X1: 16 ( 7.3 bits)
X2: 38 (14.6 bits)
X3: 64 (24.7 bits)
S1: 41 (21.7 bits)
S2: 32 (16.9 bits)


psg: 0.16 gvh: 0.13 alm: 0.48 top: 0.53 tms: 0.00 mit: 0.20 mip: 0.00
nuc: 0.37 erl: 0.00 erm: 0.00 pox: 0.00 px2: 0.00 vac: 0.00 rnp: 0.00
act: 0.00 caa: 0.00 yqr: 0.00 tyr: 0.00 leu: 0.00 gpi: 0.00 myr: 0.00
dna: 0.00 rib: 0.00 bac: 0.00 m1a: 0.00 m1b: 0.00 m2 : 0.00 mNt: 0.00
m3a: 0.00 m3b: 0.00 m_ : 1.00

68.0 %: nuclear
24.0 %: cytoplasmic
4.0 %: cytoskeletal
4.0 %: plasma membrane

>> prediction for Contig-U16068-1 is nuc

VS (DIR, S) 0
VH (FL, L) 0
VF (FL, S) 1
AH (FL, L) 0
AF (FL, S) 2
SL (DIR, L) 0
SS (DIR, S) 1
SH (FL, L) 0
SF (FL, S) 5
CH (FL, L) 3
CF (FL, S) 6
FCL (DIR, L) 0
FC (DIR, S) 0