Contig ID Contig-U16281-1
Contig update 2004. 6.11
Contig sequence
>Contig-U16281-1 (Contig-U16281-1Q) /CSM_Contig/Contig-U16281-1Q.Seq.d

Gap no gap
Contig length 1726
Chromosome number (1..6, M) 2
Chromosome length 8467578
Start point 5300993
End point 5302562
Number of clones 149
Number of EST 229
Link to clone list U16281
List of clone(s)

Translated Amino Acid sequence

Translated Amino Acid sequence (All Frames)
Frame A:

Frame B:

Frame C:

own update 2004. 6.23
Homology vs CSM-cDNA
Query= Contig-U16281-1 (Contig-U16281-1Q)
(1726 letters)

Database: CSM
8402 sequences; 8,075,542 total letters

Score E
Sequences producing significant alignments: (bits) Value

Contig-U16281-1 (Contig-U16281-1Q) /CSM_Contig/Conti... 2759 0.0
Contig-U15038-1 (Contig-U15038-1Q) /CSM_Contig/Conti... 295 1e-79
Contig-U09928-1 (Contig-U09928-1Q) /CSM_Contig/Conti... 276 1e-73
Contig-U16415-1 (Contig-U16415-1Q) /CSM_Contig/Conti... 159 2e-38
Contig-U06119-1 (Contig-U06119-1Q) /CSM_Contig/Conti... 100 1e-20
Contig-U02126-1 (Contig-U02126-1Q) /CSM_Contig/Conti... 64 8e-10
Contig-U14928-1 (Contig-U14928-1Q) /CSM_Contig/Conti... 38 0.044
Contig-U09755-1 (Contig-U09755-1Q) /CSM_Contig/Conti... 38 0.044
Contig-U16251-1 (Contig-U16251-1Q) /CSM_Contig/Conti... 36 0.17
Contig-U15983-1 (Contig-U15983-1Q) /CSM_Contig/Conti... 36 0.17

>Contig-U16281-1 (Contig-U16281-1Q) /CSM_Contig/Contig-U16281-1Q.Seq.d
Length = 1726

Score = 2759 bits (1392), Expect = 0.0
Identities = 1406/1413 (99%)
Strand = Plus / Plus

Query: 193 attaaataaaatgtttgccagattagccagagctaactacttaaagaattcaggtagata 252
Sbjct: 193 attaaataaaatgtttgccagattagccagagctaactacttaaagaattcaggtagata 252

Query: 253 cttctctactgagccaaccttaaaagaaagattagttcaaatcatcccaggtaaaattga 312
Sbjct: 253 cttctctactgagccaaccttaaaagaaagattagttcaaatcatcccaggtaaaattga 312

Query: 313 acaagttaaacaattaaaaactgaacatggtgacaaaatcattggtacctgtactgttgc 372
Sbjct: 313 acaagttaaacaattaaaaactgaacatggtgacaaaatcattggtacctgtactgttgc 372

Query: 373 acaagcttatggtggtatgagatcagttaaatcattagttactgaaacatcatcattaga 432
Sbjct: 373 acaagcttatggtggtatgagatcagttaaatcattagttactgaaacatcatcattaga 432

Query: 433 tccagaagaaggcattagattccgtggtttaacaatcccagaatgtcaagagaaattacc 492
Sbjct: 433 tccagaagaaggcattagattccgtggtttaacaatcccagaatgtcaagagaaattacc 492

Query: 493 aaaagctccaggtggtgctgaaccattaccagaaggtattttatggttacttttaactgg 552
Sbjct: 493 aaaagctccaggtggtgctgaaccattaccagaaggtattttatggttacttttaactgg 552

Query: 553 tgaagttccaactgaatcacaagttaaaaccttatcaaaagatttagctaaacgtgctgg 612
Sbjct: 553 tgaagttccaactgaatcacaagttaaaaccttatcaaaagatttagctaaacgtgctgg 612

Query: 613 tttaccaaaacacgtcacctcaatgattaaagcattcccagagcaaatgcatccaatgtc 672
Sbjct: 613 tttaccaaaacacgtcacctcaatgattaaagcattcccagagcaaatgcatccaatgtc 672

Query: 673 acaattggccgctgctattttagcactccaaggtgaaagcaaattcgtcaaagcctacaa 732
Sbjct: 673 acaattggccgctgctattttagcactccaaggtgaaagcaaattcgtcaaagcctacaa 732

Query: 733 tgatggtgtcaaaaaagataaatattgggaatcaactttagaagattctttagatgtcat 792
Sbjct: 733 tgatggtgtcaaaaaagataaatattgggaatcaactttagaagattctttagatgtcat 792

Query: 793 tgccaaattacccagaagttgcagctctcatctatcaaaacacatataaaaagagtgata 852
Sbjct: 793 tgccaaattacccagaagttgcagctctcatctatcaaaacacatataaaaagagtgata 852

Query: 853 tcactcacaaaatcgatgaaaacctcgattggtctgccaatttcaatcgtatgttgggtt 912
Sbjct: 853 tcactcacaaaatcgatgaaaacctcgattggtctgccaatttcaatcgtatgttgggtt 912

Query: 913 acacctcaaaagatttcgatgaactcatgagactttacctcaccattcatactgatcatg 972
Sbjct: 913 acacctcaaaagatttcgatgaactcatgagactttacctcaccattcatactgatcatg 972

Query: 973 aaggtggtaacgttaggtgctcatacaactcatttagtaggttccgccttatctgacagt 1032
Sbjct: 973 aaggtggtaacgttaggtgctcatacaactcatttagtaggttccgccttatctgacagt 1032

Query: 1033 tatttatcattaagtgctggtatgtgtggtcttgctggtccattacatggtttagccaat 1092
Sbjct: 1033 tatttatcattaagtgctggtatgtgtggtcttgctggtccattacatggtttagccaat 1092

Query: 1093 caagaagtactttcatggacaatgaaattacaagaaaaattaggaaacaaagaagtctca 1152
Sbjct: 1093 caagaagtactttcatggacaatgaaattacaagaaaaattaggaaacaaagaagtctca 1152

Query: 1153 aatgaagttttatcagaagccatctgggaaggtttaaacgctggtcgtgttgtaccagga 1212
Sbjct: 1153 aatgaagttttatcagaagccatctgggaaggtttaaacgctggtcgtgttgtaccagga 1212

Query: 1213 tttggtcatgccgtcttaagaaagactgatccacgttacacttgtcaacgtgagtttgct 1272
Sbjct: 1213 tttggtcatgccgtcttaagaaagactgatccacgttacacttgtcaacgtgagtttgct 1272

Query: 1273 cttaaacatttaccacaagatccattattcaaattagtcagccaaatctacgaagttgtt 1332
Sbjct: 1273 cttaaacatttaccacaagatccattattcaaattagtcagccaaatctacgaagttgtt 1332

Query: 1333 ccagatattttaactaaacacggtaaaaccaagaacccatatccaaatgttgatgctcac 1392
Sbjct: 1333 ccagatattttaactaaacacggtaaaaccaagaacccatatccaaatgttgatgctcac 1392

Query: 1393 tctggttgtttattacaatactatggcttaaaagaacataacttctacactgttttattc 1452
Sbjct: 1393 tctggttgtttattacaatactatggcttaaaagaacataacttctacactgttttattc 1452

Query: 1453 ggtgtttcaagagccattggtgttttatcatcattagtttgggatcgtatcttaggtcac 1512
Sbjct: 1453 ggtgtttcaagagccattggtgttttatcatcattagtttgggatcgtatcttaggtcac 1512

Query: 1513 ccaatcgaaagaccaaaatcagtcaccactgaatggatttcatcttacgtaaactctgac 1572
Sbjct: 1513 ccaatcgaaagaccaaaatcagtcaccactgaatggatttcatcttacgtaaactctgac 1572

Query: 1573 caatcnnnnnnntaaatttaagtaataaaatct 1605
||||| |||||||||||||||||||||
Sbjct: 1573 caatcaaaaaaataaatttaagtaataaaatct 1605

Score = 295 bits (149), Expect = 1e-79
Identities = 149/149 (100%)
Strand = Plus / Plus

Query: 1 acgaaactgaccattaagagtactccttcgaaacaattttgagtggttgttagtaaggct 60
Sbjct: 1 acgaaactgaccattaagagtactccttcgaaacaattttgagtggttgttagtaaggct 60

Query: 61 ttttctggcaaaaagagaaattagagagagatctttaaacaactgggtttagaaattcta 120
Sbjct: 61 ttttctggcaaaaagagaaattagagagagatctttaaacaactgggtttagaaattcta 120

Query: 121 tgatcatttcggttgtgccaagatctcac 149
Sbjct: 121 tgatcatttcggttgtgccaagatctcac 149

Score = 81.8 bits (41), Expect = 3e-15
Identities = 41/41 (100%)
Strand = Plus / Plus

Query: 1621 tagatatcgacaagtaaaaaatattttttggttctacattc 1661
Sbjct: 1621 tagatatcgacaagtaaaaaatattttttggttctacattc 1661

>Contig-U15038-1 (Contig-U15038-1Q) /CSM_Contig/Contig-U15038-1Q.Seq.d
Length = 1169

Score = 295 bits (149), Expect = 1e-79
Identities = 149/149 (100%)
Strand = Plus / Plus

Query: 1 acgaaactgaccattaagagtactccttcgaaacaattttgagtggttgttagtaaggct 60
Sbjct: 1 acgaaactgaccattaagagtactccttcgaaacaattttgagtggttgttagtaaggct 60

Query: 61 ttttctggcaaaaagagaaattagagagagatctttaaacaactgggtttagaaattcta 120
Sbjct: 61 ttttctggcaaaaagagaaattagagagagatctttaaacaactgggtttagaaattcta 120

Query: 121 tgatcatttcggttgtgccaagatctcac 149
Sbjct: 121 tgatcatttcggttgtgccaagatctcac 149

>Contig-U09928-1 (Contig-U09928-1Q) /CSM_Contig/Contig-U09928-1Q.Seq.d
Length = 1357

Score = 276 bits (139), Expect = 1e-73
Identities = 146/147 (99%), Gaps = 1/147 (0%)
Strand = Plus / Plus

Query: 3 gaaactgaccattaagagtactccttcgaaacaattttgagtggttgttagtaaggcttt 62
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3 gaaactgacc-ttaagagtactccttcgaaacaattttgagtggttgttagtaaggcttt 61

Query: 63 ttctggcaaaaagagaaattagagagagatctttaaacaactgggtttagaaattctatg 122
Sbjct: 62 ttctggcaaaaagagaaattagagagagatctttaaacaactgggtttagaaattctatg 121

Query: 123 atcatttcggttgtgccaagatctcac 149
Sbjct: 122 atcatttcggttgtgccaagatctcac 148

Database: CSM
Posted date: Jun 21, 2004 1:35 PM
Number of letters in database: 8,075,542
Number of sequences in database: 8402

Lambda K H
1.37 0.711 1.31

Lambda K H
1.37 0.711 1.31

Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 19,424
Number of Sequences: 8402
Number of extensions: 19424
Number of successful extensions: 1883
Number of sequences better than 10.0: 63
length of query: 1726
length of database: 8,075,542
effective HSP length: 16
effective length of query: 1710
effective length of database: 7,941,110
effective search space: 13579298100
effective search space used: 13579298100
T: 0
A: 40
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 16 (32.2 bits)
dna update 2009. 3.24
Homology vs DNA
Query= Contig-U16281-1 (Contig-U16281-1Q) /CSM_Contig/Contig-U16281-1Q.Seq.d
(1726 letters)

Database: ddbj_B
98,226,423 sequences; 98,766,808,389 total letters


Score E
Sequences producing significant alignments: (bits) Value N

(BJ343985) Dictyostelium discoideum cDNA clone:dda17g21, 3' ... 1354 0.0 1
(BJ429047) Dictyostelium discoideum cDNA clone:ddv2n03, 3' e... 1312 0.0 1
(BJ401167) Dictyostelium discoideum cDNA clone:dds22j08, 3' ... 1289 0.0 1
(AU061897) Dictyostelium discoideum slug cDNA, clone SLG531. 1189 0.0 2
(BJ434286) Dictyostelium discoideum cDNA clone:ddv16m11, 3' ... 1181 0.0 4
(BJ326718) Dictyostelium discoideum cDNA clone:dda17b19, 5' ... 1179 0.0 1
(BJ412812) Dictyostelium discoideum cDNA clone:ddv9o22, 5' e... 1178 0.0 1
(BJ410471) Dictyostelium discoideum cDNA clone:ddv12m18, 5' ... 1178 0.0 1
(BJ327740) Dictyostelium discoideum cDNA clone:dda21h16, 5' ... 1176 0.0 1
(BJ414337) Dictyostelium discoideum cDNA clone:ddv18g21, 5' ... 1174 0.0 1
(BJ387582) Dictyostelium discoideum cDNA clone:dds3d17, 5' e... 1174 0.0 1
(BJ416529) Dictyostelium discoideum cDNA clone:ddv26p14, 5' ... 1172 0.0 1
(BJ415015) Dictyostelium discoideum cDNA clone:ddv21m02, 5' ... 1172 0.0 1
(BJ413790) Dictyostelium discoideum cDNA clone:ddv17a01, 5' ... 1172 0.0 1
(BJ412300) Dictyostelium discoideum cDNA clone:ddv7c24, 5' e... 1172 0.0 1
(BJ412564) Dictyostelium discoideum cDNA clone:ddv9e04, 5' e... 1170 0.0 1
(BJ412203) Dictyostelium discoideum cDNA clone:ddv7h11, 5' e... 1170 0.0 1
(BJ410334) Dictyostelium discoideum cDNA clone:ddv12j06, 5' ... 1170 0.0 1
(BJ412775) Dictyostelium discoideum cDNA clone:ddv9f23, 5' e... 1168 0.0 1
(BJ328769) Dictyostelium discoideum cDNA clone:dda29n11, 5' ... 1168 0.0 1
(BJ414197) Dictyostelium discoideum cDNA clone:ddv18j10, 5' ... 1164 0.0 1
(BJ390889) Dictyostelium discoideum cDNA clone:dds14i03, 5' ... 1162 0.0 1
(BJ325973) Dictyostelium discoideum cDNA clone:dda3a08, 5' e... 1162 0.0 1
(BJ430496) Dictyostelium discoideum cDNA clone:ddv7p07, 3' e... 1160 0.0 2
(AU263163) Dictyostelium discoideum vegetative cDNA clone:VS... 1152 0.0 3
(BJ433554) Dictyostelium discoideum cDNA clone:ddv22b10, 3' ... 1150 0.0 3
(BJ432134) Dictyostelium discoideum cDNA clone:ddv17c19, 3' ... 1150 0.0 2
(BJ430854) Dictyostelium discoideum cDNA clone:ddv9e04, 3' e... 1150 0.0 3
(BJ430575) Dictyostelium discoideum cDNA clone:ddv7c24, 3' e... 1150 0.0 2
(BJ428053) Dictyostelium discoideum cDNA clone:ddv10h17, 3' ... 1150 0.0 2
(BJ402004) Dictyostelium discoideum cDNA clone:dds20j03, 3' ... 1150 0.0 2
(BJ401198) Dictyostelium discoideum cDNA clone:dds22o12, 3' ... 1150 0.0 2
(BJ399219) Dictyostelium discoideum cDNA clone:dds4h23, 3' e... 1150 0.0 2
(BJ345289) Dictyostelium discoideum cDNA clone:dda23a09, 3' ... 1150 0.0 2
(BJ341728) Dictyostelium discoideum cDNA clone:dda7n24, 3' e... 1150 0.0 2
(BJ341653) Dictyostelium discoideum cDNA clone:dda7i14, 3' e... 1150 0.0 2
(BJ428486) Dictyostelium discoideum cDNA clone:ddv12j06, 3' ... 1146 0.0 2
(BJ431444) Dictyostelium discoideum cDNA clone:ddv14o02, 3' ... 1142 0.0 2
(BJ374074) Dictyostelium discoideum cDNA clone:ddc6l09, 3' e... 1142 0.0 2
(BJ342960) Dictyostelium discoideum cDNA clone:dda15g16, 3' ... 1142 0.0 2
(BJ390581) Dictyostelium discoideum cDNA clone:dds22o23, 5' ... 1138 0.0 1
(AU261826) Dictyostelium discoideum vegetative cDNA clone:VS... 1136 0.0 1
(BJ416243) Dictyostelium discoideum cDNA clone:ddv25m12, 5' ... 1136 0.0 1
(BJ329522) Dictyostelium discoideum cDNA clone:dda25e11, 5' ... 1136 0.0 1
(BJ431171) Dictyostelium discoideum cDNA clone:ddv13i03, 3' ... 1134 0.0 2
(BJ415078) Dictyostelium discoideum cDNA clone:ddv21i11, 5' ... 1134 0.0 1
(BJ410747) Dictyostelium discoideum cDNA clone:ddv1o18, 5' e... 1134 0.0 1
(BJ324214) Dictyostelium discoideum cDNA clone:dda5f12, 5' e... 1134 0.0 1
(BJ416658) Dictyostelium discoideum cDNA clone:ddv26i06, 5' ... 1132 0.0 1
(BJ415558) Dictyostelium discoideum cDNA clone:ddv22p19, 5' ... 1132 0.0 1
(BJ412405) Dictyostelium discoideum cDNA clone:ddv8f11, 5' e... 1132 0.0 1
(AU270258) Dictyostelium discoideum vegetative cDNA clone:VS... 1130 0.0 2
(BJ412076) Dictyostelium discoideum cDNA clone:ddv6j24, 5' e... 1130 0.0 1
(BJ410622) Dictyostelium discoideum cDNA clone:ddv1b08, 5' e... 1130 0.0 1
(BJ358370) Dictyostelium discoideum cDNA clone:ddc1b11, 5' e... 1126 0.0 1
(BJ416507) Dictyostelium discoideum cDNA clone:ddv26k17, 5' ... 1124 0.0 1
(BJ412345) Dictyostelium discoideum cDNA clone:ddv8b05, 5' e... 1122 0.0 1
(BJ417542) Dictyostelium discoideum cDNA clone:ddv30o20, 5' ... 1120 0.0 1
(BJ411959) Dictyostelium discoideum cDNA clone:ddv6p09, 5' e... 1118 0.0 1
(BJ324710) Dictyostelium discoideum cDNA clone:dda7i14, 5' e... 1118 0.0 1
(BJ416910) Dictyostelium discoideum cDNA clone:ddv27a23, 5' ... 1116 0.0 1
(BJ415339) Dictyostelium discoideum cDNA clone:ddv22b10, 5' ... 1116 0.0 1
(BJ329869) Dictyostelium discoideum cDNA clone:dda26g15, 5' ... 1116 0.0 1
(BJ324561) Dictyostelium discoideum cDNA clone:dda6l24, 5' e... 1116 0.0 1
(AU270257) Dictyostelium discoideum vegetative cDNA clone:VS... 1114 0.0 2
(BJ417770) Dictyostelium discoideum cDNA clone:ddv28p17, 5' ... 1112 0.0 1
(BJ411445) Dictyostelium discoideum cDNA clone:ddv4p08, 5' e... 1112 0.0 1
(BJ359375) Dictyostelium discoideum cDNA clone:ddc14k04, 5' ... 1110 0.0 1
(BJ326177) Dictyostelium discoideum cDNA clone:dda15g16, 5' ... 1110 0.0 1
(BJ410531) Dictyostelium discoideum cDNA clone:ddv12k22, 5' ... 1108 0.0 1
(BJ435631) Dictyostelium discoideum cDNA clone:ddv27a23, 3' ... 1104 0.0 4
(BJ433476) Dictyostelium discoideum cDNA clone:ddv22c03, 3' ... 1104 0.0 3
(BJ431973) Dictyostelium discoideum cDNA clone:ddv17o05, 3' ... 1104 0.0 3
(BJ430916) Dictyostelium discoideum cDNA clone:ddv9c09, 3' e... 1104 0.0 3
(BJ430625) Dictyostelium discoideum cDNA clone:ddv8b05, 3' e... 1104 0.0 3
(BJ430594) Dictyostelium discoideum cDNA clone:ddv7j20, 3' e... 1104 0.0 3
(BJ429213) Dictyostelium discoideum cDNA clone:ddv2a19, 3' e... 1104 0.0 3
(BJ401149) Dictyostelium discoideum cDNA clone:dds22e12, 3' ... 1104 0.0 3
(BJ400635) Dictyostelium discoideum cDNA clone:dds14i03, 3' ... 1104 0.0 3
(BJ371880) Dictyostelium discoideum cDNA clone:ddc10j02, 3' ... 1104 0.0 3
(BJ347259) Dictyostelium discoideum cDNA clone:dda26g15, 3' ... 1104 0.0 3
(BJ345383) Dictyostelium discoideum cDNA clone:dda23d14, 3' ... 1104 0.0 3
(BJ342375) Dictyostelium discoideum cDNA clone:dda13o16, 3' ... 1104 0.0 3
(BJ342124) Dictyostelium discoideum cDNA clone:dda9i17, 3' e... 1104 0.0 3
(BJ436051) Dictyostelium discoideum cDNA clone:ddv29o13, 3' ... 1098 0.0 3
(BJ414644) Dictyostelium discoideum cDNA clone:ddv19p19, 5' ... 1098 0.0 1
(BJ436365) Dictyostelium discoideum cDNA clone:ddv30o20, 3' ... 1096 0.0 3
(BJ433294) Dictyostelium discoideum cDNA clone:ddv21i11, 3' ... 1096 0.0 3
(BJ432937) Dictyostelium discoideum cDNA clone:ddv20e08, 3' ... 1096 0.0 3
(BJ430463) Dictyostelium discoideum cDNA clone:ddv7h11, 3' e... 1096 0.0 3
(BJ428597) Dictyostelium discoideum cDNA clone:ddv12e16, 3' ... 1096 0.0 3
(BJ428338) Dictyostelium discoideum cDNA clone:ddv11g14, 3' ... 1096 0.0 3
(BJ399566) Dictyostelium discoideum cDNA clone:dds6d16, 3' e... 1096 0.0 3
(BJ398466) Dictyostelium discoideum cDNA clone:dds12e15, 3' ... 1096 0.0 3
(BJ375161) Dictyostelium discoideum cDNA clone:ddc17m15, 3' ... 1096 0.0 3
(C23821) Dictyostelium discoideum gamete cDNA, clone FCL-AB18. 1090 0.0 2
(BJ415953) Dictyostelium discoideum cDNA clone:ddv24e11, 5' ... 1090 0.0 1
(BJ412470) Dictyostelium discoideum cDNA clone:ddv8i17, 5' e... 1090 0.0 1
(BJ401346) Dictyostelium discoideum cDNA clone:dds22o23, 3' ... 1090 0.0 2
(BJ325296) Dictyostelium discoideum cDNA clone:dda13o16, 5' ... 1090 0.0 1
(BJ323804) Dictyostelium discoideum cDNA clone:dda12g07, 5' ... 1090 0.0 1
(BJ436136) Dictyostelium discoideum cDNA clone:ddv30h04, 3' ... 1088 0.0 3
(BJ413861) Dictyostelium discoideum cDNA clone:ddv17o05, 5' ... 1088 0.0 1
(BJ390447) Dictyostelium discoideum cDNA clone:dds22o12, 5' ... 1088 0.0 1
(BJ387146) Dictyostelium discoideum cDNA clone:dds12e15, 5' ... 1088 0.0 1
(BJ324988) Dictyostelium discoideum cDNA clone:dda9e05, 5' e... 1088 0.0 1
(BJ416302) Dictyostelium discoideum cDNA clone:ddv25o18, 5' ... 1086 0.0 1
(BJ413349) Dictyostelium discoideum cDNA clone:ddv15n03, 5' ... 1086 0.0 1
(BJ411546) Dictyostelium discoideum cDNA clone:ddv4h23, 5' e... 1086 0.0 1
(BJ410439) Dictyostelium discoideum cDNA clone:ddv12e16, 5' ... 1086 0.0 1
(BJ390405) Dictyostelium discoideum cDNA clone:dds22e12, 5' ... 1086 0.0 1
(BJ388300) Dictyostelium discoideum cDNA clone:dds8k23, 5' e... 1086 0.0 1
(BJ361795) Dictyostelium discoideum cDNA clone:ddc18d24, 5' ... 1086 0.0 1
(BJ328179) Dictyostelium discoideum cDNA clone:dda23a09, 5' ... 1086 0.0 1
(BJ429658) Dictyostelium discoideum cDNA clone:ddv4n11, 3' e... 1084 0.0 2
(BJ410278) Dictyostelium discoideum cDNA clone:ddv11l22, 5' ... 1084 0.0 1
(BJ361986) Dictyostelium discoideum cDNA clone:ddc19j16, 5' ... 1082 0.0 1
(BJ412999) Dictyostelium discoideum cDNA clone:ddv13d19, 5' ... 1078 0.0 1
(BJ411440) Dictyostelium discoideum cDNA clone:ddv4n11, 5' e... 1078 0.0 1
(BJ411025) Dictyostelium discoideum cDNA clone:ddv2a19, 5' e... 1078 0.0 1
(BJ389800) Dictyostelium discoideum cDNA clone:dds20j03, 5' ... 1078 0.0 1
(BJ361550) Dictyostelium discoideum cDNA clone:ddc17m15, 5' ... 1078 0.0 1
(BJ329965) Dictyostelium discoideum cDNA clone:dda26k24, 5' ... 1078 0.0 1
(BJ341716) Dictyostelium discoideum cDNA clone:dda7j24, 3' e... 1074 0.0 2
(BJ428737) Dictyostelium discoideum cDNA clone:ddv1f01, 3' e... 1072 0.0 2
(BJ340256) Dictyostelium discoideum cDNA clone:dda12g07, 3' ... 1013 0.0 3
(C23820) Dictyostelium discoideum gamete cDNA, clone FCL-AB18. 1001 0.0 3
(BJ341749) Dictyostelium discoideum cDNA clone:dda8d03, 3' e... 991 0.0 4
(BJ398995) Dictyostelium discoideum cDNA clone:dds3d17, 3' e... 904 0.0 4
(BJ428429) Dictyostelium discoideum cDNA clone:ddv11l22, 3' ... 872 0.0 3
(AC116305) Dictyostelium discoideum chromosome 2 map 1005175... 848 0.0 3
(BJ431125) Dictyostelium discoideum cDNA clone:ddv9o22, 3' e... 739 0.0 4
(BJ412936) Dictyostelium discoideum cDNA clone:ddv13b15, 5' ... 702 0.0 2
(BJ386853) Dictyostelium discoideum cDNA clone:dds11a04, 5' ... 948 0.0 3
(BJ413107) Dictyostelium discoideum cDNA clone:ddv14o02, 5' ... 1072 0.0 1
(BJ412623) Dictyostelium discoideum cDNA clone:ddv9c09, 5' e... 1070 0.0 1
(BJ413279) Dictyostelium discoideum cDNA clone:ddv14n19, 5' ... 1068 0.0 1
(BJ386841) Dictyostelium discoideum cDNA clone:dds10m24, 5' ... 1065 0.0 1
(BJ415262) Dictyostelium discoideum cDNA clone:ddv22c03, 5' ... 1061 0.0 1
(BJ326735) Dictyostelium discoideum cDNA clone:dda17g21, 5' ... 1061 0.0 1
(BJ412228) Dictyostelium discoideum cDNA clone:ddv7p07, 5' e... 1059 0.0 1
(BJ361042) Dictyostelium discoideum cDNA clone:ddc9e15, 5' e... 1059 0.0 1
(BJ324761) Dictyostelium discoideum cDNA clone:dda7j24, 5' e... 1059 0.0 1
(BJ410631) Dictyostelium discoideum cDNA clone:ddv1d07, 5' e... 1057 0.0 1
(BJ363556) Dictyostelium discoideum cDNA clone:ddc27c11, 5' ... 1057 0.0 1
(BJ324786) Dictyostelium discoideum cDNA clone:dda8d03, 5' e... 1057 0.0 1
(BJ413904) Dictyostelium discoideum cDNA clone:ddv17h12, 5' ... 1051 0.0 1
(BJ390422) Dictyostelium discoideum cDNA clone:dds22j08, 5' ... 1051 0.0 1
(AU270394) Dictyostelium discoideum vegetative cDNA clone:VS... 1049 0.0 1
(BJ416471) Dictyostelium discoideum cDNA clone:ddv26d18, 5' ... 1043 0.0 1
(BJ414845) Dictyostelium discoideum cDNA clone:ddv20h15, 5' ... 1035 0.0 1
(BJ431855) Dictyostelium discoideum cDNA clone:ddv15f23, 3' ... 1031 0.0 1
(BJ410942) Dictyostelium discoideum cDNA clone:ddv2n09, 5' e... 1021 0.0 1
(AU271277) Dictyostelium discoideum vegetative cDNA clone:VS... 1015 0.0 1
(BJ413022) Dictyostelium discoideum cDNA clone:ddv13j24, 5' ... 1015 0.0 1
(BJ431329) Dictyostelium discoideum cDNA clone:ddv13d19, 3' ... 999 0.0 2
(AU053365) Dictyostelium discoideum slug cDNA, clone SLI468. 1003 0.0 1
(BJ409886) Dictyostelium discoideum cDNA clone:ddv10l11, 5' ... 1003 0.0 1
(BJ409932) Dictyostelium discoideum cDNA clone:ddv10h17, 5' ... 995 0.0 1
(BJ410571) Dictyostelium discoideum cDNA clone:ddv1f01, 5' e... 993 0.0 1
(BJ415043) Dictyostelium discoideum cDNA clone:ddv21b12, 5' ... 987 0.0 1
(BJ412939) Dictyostelium discoideum cDNA clone:ddv13c13, 5' ... 985 0.0 1
(BJ428147) Dictyostelium discoideum cDNA clone:ddv10m19, 3' ... 981 0.0 1
(BJ417055) Dictyostelium discoideum cDNA clone:ddv29c11, 5' ... 981 0.0 1
(AU261819) Dictyostelium discoideum vegetative cDNA clone:VS... 979 0.0 1
(BJ387773) Dictyostelium discoideum cDNA clone:dds4h23, 5' e... 977 0.0 1
(AU271276) Dictyostelium discoideum vegetative cDNA clone:VS... 456 0.0 3
(BJ413626) Dictyostelium discoideum cDNA clone:ddv16m11, 5' ... 942 0.0 2
(BJ417166) Dictyostelium discoideum cDNA clone:ddv29o13, 5' ... 954 0.0 1
(BJ410877) Dictyostelium discoideum cDNA clone:ddv2n03, 5' e... 944 0.0 1
(BJ330183) Dictyostelium discoideum cDNA clone:dda27l15, 5' ... 944 0.0 1
(BJ417282) Dictyostelium discoideum cDNA clone:ddv30h04, 5' ... 942 0.0 1
(BJ412252) Dictyostelium discoideum cDNA clone:ddv7e13, 5' e... 938 0.0 1
(BJ388636) Dictyostelium discoideum cDNA clone:dds6d16, 5' e... 938 0.0 1
(BJ412952) Dictyostelium discoideum cDNA clone:ddv13f14, 5' ... 936 0.0 1
(BJ411854) Dictyostelium discoideum cDNA clone:ddv6h01, 5' e... 936 0.0 1
(BJ417530) Dictyostelium discoideum cDNA clone:ddv30l24, 5' ... 934 0.0 1
(BJ417034) Dictyostelium discoideum cDNA clone:ddv29o01, 5' ... 934 0.0 1
(BJ324773) Dictyostelium discoideum cDNA clone:dda7n24, 5' e... 934 0.0 1
(BJ358553) Dictyostelium discoideum cDNA clone:ddc10j02, 5' ... 918 0.0 1
(BJ412318) Dictyostelium discoideum cDNA clone:ddv7j20, 5' e... 496 0.0 2
(BJ328258) Dictyostelium discoideum cDNA clone:dda23d14, 5' ... 900 0.0 1
(BJ412852) Dictyostelium discoideum cDNA clone:ddv13i03, 5' ... 898 0.0 1
(BJ429663) Dictyostelium discoideum cDNA clone:ddv4p08, 3' e... 825 0.0 3
(BJ429123) Dictyostelium discoideum cDNA clone:ddv2n09, 3' e... 892 0.0 1
(BJ409902) Dictyostelium discoideum cDNA clone:ddv10a18, 5' ... 890 0.0 1
(AU261974) Dictyostelium discoideum vegetative cDNA clone:VS... 833 0.0 2
(BJ414748) Dictyostelium discoideum cDNA clone:ddv20e08, 5' ... 884 0.0 1
(BJ410018) Dictyostelium discoideum cDNA clone:ddv10m19, 5' ... 882 0.0 1
(BJ410192) Dictyostelium discoideum cDNA clone:ddv11g14, 5' ... 613 0.0 2
(BJ410285) Dictyostelium discoideum cDNA clone:ddv11n20, 5' ... 860 0.0 1
(BJ417240) Dictyostelium discoideum cDNA clone:ddv29o24, 5' ... 852 0.0 1
(BJ411639) Dictyostelium discoideum cDNA clone:ddv5p01, 5' e... 769 0.0 3
(AU053464) Dictyostelium discoideum slug cDNA, clone SLI709. 801 0.0 1
(BJ431703) Dictyostelium discoideum cDNA clone:ddv15n03, 3' ... 599 0.0 4
(BJ413403) Dictyostelium discoideum cDNA clone:ddv15n07, 5' ... 775 0.0 1
(BJ413001) Dictyostelium discoideum cDNA clone:ddv13d21, 5' ... 775 0.0 1
(BJ410002) Dictyostelium discoideum cDNA clone:ddv10i21, 5' ... 773 0.0 1
(BJ428021) Dictyostelium discoideum cDNA clone:ddv10a18, 3' ... 726 0.0 1
(BJ325544) Dictyostelium discoideum cDNA clone:dda1g11, 5' e... 726 0.0 1
(BJ429870) Dictyostelium discoideum cDNA clone:ddv5m04, 3' e... 391 0.0 3
(BJ416081) Dictyostelium discoideum cDNA clone:ddv24l19, 5' ... 581 e-161 1
(BJ414568) Dictyostelium discoideum cDNA clone:ddv19l13, 5' ... 581 e-161 1
(BJ411785) Dictyostelium discoideum cDNA clone:ddv5e23, 5' e... 551 e-156 2
(BJ429847) Dictyostelium discoideum cDNA clone:ddv5h04, 3' e... 509 e-150 2
(BJ411637) Dictyostelium discoideum cDNA clone:ddv5o04, 5' e... 511 e-140 1
(BJ413556) Dictyostelium discoideum cDNA clone:ddv16o02, 5' ... 509 e-139 1
(BJ433796) Dictyostelium discoideum cDNA clone:ddv22p19, 3' ... 458 e-129 2
(BJ411611) Dictyostelium discoideum cDNA clone:ddv5h04, 5' e... 458 e-124 1
(BJ432484) Dictyostelium discoideum cDNA clone:ddv18g21, 3' ... 440 e-119 1
(BJ411708) Dictyostelium discoideum cDNA clone:ddv5a16, 5' e... 289 e-117 2
(BJ432384) Dictyostelium discoideum cDNA clone:ddv18d18, 3' ... 402 e-116 2
(BJ411627) Dictyostelium discoideum cDNA clone:ddv5m04, 5' e... 309 e-112 2
(BJ414250) Dictyostelium discoideum cDNA clone:ddv18d18, 5' ... 389 e-103 1
(BJ389498) Dictyostelium discoideum cDNA clone:dds19a04, 5' ... 278 e-102 2
(BJ435111) Dictyostelium discoideum cDNA clone:ddv26i06, 3' ... 381 e-101 1
(BJ360495) Dictyostelium discoideum cDNA clone:ddc6l09, 5' e... 367 9e-97 1
(AU062251) Dictyostelium discoideum slug cDNA, clone SLI709. 365 4e-96 1
(BJ434206) Dictyostelium discoideum cDNA clone:ddv16o02, 3' ... 325 6e-90 2
(BJ443244) Dictyostelium discoideum cDNA clone:ddv52h10, 3' ... 206 6e-87 2
(BJ347368) Dictyostelium discoideum cDNA clone:dda26k24, 3' ... 270 3e-76 2
(BJ413318) Dictyostelium discoideum cDNA clone:ddv15g01, 5' ... 295 3e-75 1
(BJ374855) Dictyostelium discoideum cDNA clone:ddc16e13, 3' ... 276 3e-69 1
(BJ325020) Dictyostelium discoideum cDNA clone:dda9c11, 5' e... 270 2e-67 1
(BJ363440) Dictyostelium discoideum cDNA clone:ddc26m15, 5' ... 264 1e-65 1
(BJ431900) Dictyostelium discoideum cDNA clone:ddv17a01, 3' ... 260 2e-64 1
(BJ434761) Dictyostelium discoideum cDNA clone:ddv24l19, 3' ... 256 2e-63 1
(BJ432822) Dictyostelium discoideum cDNA clone:ddv19p19, 3' ... 242 4e-59 1
(BJ375689) Dictyostelium discoideum cDNA clone:ddc19j16, 3' ... 238 6e-58 1
(AL409253) T7 end of clone AV0AA013G12 of library AV0AA from... 70 3e-54 9
(BJ417858) Dictyostelium discoideum cDNA clone:ddv15f23, 5' ... 222 3e-53 1
(AY145050) Kluyveromyces lactis clone P2263 CIT1 gene, parti... 101 1e-50 8
(BJ414039) Dictyostelium discoideum cDNA clone:ddv17h23, 5' ... 210 1e-49 1
(BD309247) Drug targets in Candida albicans. 76 4e-48 9
(BJ435245) Dictyostelium discoideum cDNA clone:ddv26d18, 3' ... 198 5e-46 1
(BJ432744) Dictyostelium discoideum cDNA clone:ddv19l13, 3' ... 196 2e-45 1
(EH012610) USDA-FP_185493 Lysiphlebus testaceipes adult whol... 113 2e-43 5
(DL131133) Bax-responsive genes for drug target identificati... 76 7e-40 7
(AX536976) Sequence 577 from Patent WO02064766. 76 7e-40 7
(AR941693) Sequence 577 from patent US 7101990. 76 7e-40 7
(AR548070) Sequence 3201 from patent US 6747137. 76 7e-40 7
(BJ435281) Dictyostelium discoideum cDNA clone:ddv26k17, 3' ... 172 3e-38 1
(CT836761) Oryza sativa (indica cultivar-group) cDNA clone:O... 62 1e-37 7
(EH014934) USDA-FP_187585 Lysiphlebus testaceipes adult whol... 64 2e-36 7
(FE260661) CAZO1121.rev CAZO Naegleria gruberi Flagellate St... 72 2e-35 5
(FE231317) CAPG1157.rev CAPG Naegleria gruberi amoeba stage ... 72 3e-35 5
(FE240379) CAPG5824.rev CAPG Naegleria gruberi amoeba stage ... 72 4e-35 5
(EC761690) PSE00008341 rw_mgpallid Polysphondylium pallidum ... 58 7e-35 5
(BJ394909) Dictyostelium discoideum cDNA clone:dds36o19, 5' ... 159 4e-34 1
(EH013275) USDA-FP_186091 Lysiphlebus testaceipes adult whol... 64 4e-33 6
(EC760453) PSE00001027 rw_mgpallid Polysphondylium pallidum ... 58 1e-32 5
(AU270395) Dictyostelium discoideum vegetative cDNA clone:VS... 151 1e-31 1
(AM806548) Nicotiana tabacum EST, clone nt005035014. 86 5e-31 4
(FF314876) 279396355 Pea aphid whole body normalized full le... 72 7e-31 5
(FE264801) CAZO4084.rev CAZO Naegleria gruberi Flagellate St... 72 8e-31 5
(FF315370) 279418892 Pea aphid whole body normalized full le... 72 8e-31 5
(FE246848) CAPG9637.rev CAPG Naegleria gruberi amoeba stage ... 72 9e-31 5
(FE259599) CAPH7794.rev CAPH Naegleria gruberi amoeba stage ... 72 1e-30 5
(BJ342723) Dictyostelium discoideum cDNA clone:dda1g11, 3' e... 119 1e-29 2
(DQ332672) Synthetic construct Saccharomyces cerevisiae clon... 62 2e-29 6
(EA376859) Sequence 25682 from patent US 7314974. 62 2e-29 6
(DJ207767) Method for identification of useful proteins deri... 62 2e-29 6
(AX832400) Sequence 3120 from Patent WO03072602. 62 2e-29 6
(AX821370) Sequence 3120 from Patent EP1338608. 62 2e-29 6
(BJ430211) Dictyostelium discoideum cDNA clone:ddv6p09, 3' e... 143 3e-29 1
(Z23259) S.cerevisiae mitochondrial citrate synthase gene, c... 62 3e-29 6
(BJ435300) Dictyostelium discoideum cDNA clone:ddv26p14, 3' ... 82 7e-29 2
(X00782) Yeast gene for citrate synthase. 62 3e-28 6
(CU437204) Clytia hemisphaerica 5-PRIME EST from clone SA0AA... 72 7e-28 7
(FE260662) CAZO1121.fwd CAZO Naegleria gruberi Flagellate St... 72 4e-27 4
(Z71616) S.cerevisiae chromosome XIV reading frame ORF YNR001c. 62 5e-27 6
(EC387370) G05_G05g1l9_pDNRf_451948 Myzus persicae, tobacco ... 76 2e-26 4
(EE261685) E04_E04ff3k7_pDNRf_514308 Myzus persicae, line F0... 76 1e-24 4
(AF193854) Saccharomyces kluyveri putative citrate synthase ... 66 2e-24 7
(AY144810) Saccharomyces bayanus clone Contig3962 CIT1 gene,... 64 3e-24 6
(EH632791) EST3898 LK04 Laupala kohalensis cDNA clone 106102... 68 5e-24 4
(AM989984) Zygosaccharomyces rouxii strain CBS 732 Contig5. 58 7e-24 10
(X77395) S.cerevisiae N2019, N2021, N2023, N2025, N2027, N20... 62 1e-23 6
(AY126274) Candida krusei citrate synthase (CS1) gene, compl... 54 3e-23 6
(BJ430686) Dictyostelium discoideum cDNA clone:ddv8f11, 3' e... 92 4e-23 2
(EH009748) USDA-FP_182915 Lysiphlebus testaceipes adult whol... 64 7e-22 4
(EU444262) Saccharomyces paradoxus strain T76.6 CIT2 gene, p... 64 8e-22 5
(EU444261) Saccharomyces paradoxus strain T68.2 CIT2 gene, p... 64 8e-22 5
(EU444259) Saccharomyces paradoxus strain T32.1 CIT2 gene, p... 64 8e-22 5
(EU444258) Saccharomyces paradoxus strain T26.3 CIT2 gene, p... 64 8e-22 5
(EU444257) Saccharomyces paradoxus strain T18.2 CIT2 gene, p... 64 8e-22 5
(EU444256) Saccharomyces paradoxus strain Q43.5 CIT2 gene, p... 64 8e-22 5
(EU444255) Saccharomyces paradoxus strain Q15.1 CIT2 gene, p... 64 8e-22 5
(EU444254) Saccharomyces paradoxus strain Q14.4 CIT2 gene, p... 64 8e-22 5
(EU444253) Saccharomyces paradoxus strain Q6.1 CIT2 gene, pa... 64 8e-22 5
(EU444252) Saccharomyces paradoxus strain Q4.1 CIT2 gene, pa... 64 8e-22 5
(EU444260) Saccharomyces paradoxus strain T62.1 CIT2 gene, p... 64 8e-22 5
(CN764018) ID0AAA8DA01RM1 ApMS Acyrthosiphon pisum cDNA clon... 72 9e-22 4
(CN754784) ID0AAA14AA07RM1 ApMS Acyrthosiphon pisum cDNA clo... 72 9e-22 4
(AJ229626) Kluyveromyces lactis DNA fragment for sequence ta... 101 1e-21 2
(DW012870) w18d19_M13F Myzus persicae, tobacco lineage, whol... 76 3e-21 4
(FC820732) Sr_pAMT7_018j17_T7 S. ratti mixed stage pAMP Stro... 78 3e-21 5
(BJ347624) Dictyostelium discoideum cDNA clone:dda27l15, 3' ... 72 5e-21 3
(DY895465) CeleSEQ15305 Cunninghamella elegans pBluescript (... 70 1e-20 5
(FE266132) CAZO4933.fwd CAZO Naegleria gruberi Flagellate St... 72 1e-20 4
(EX149107) ZRB166R ZRB Zoophthora radicans cDNA clone ZRB166... 52 5e-20 5
(FE266131) CAZO4933.rev CAZO Naegleria gruberi Flagellate St... 72 5e-20 4
(DJ131610) Method for identification of useful proteins deri... 52 5e-20 5
(AM809607) Nicotiana tabacum EST, clone nt005025061. 56 6e-20 4
(EE570402) E06_E06fm4k11_pDNRf_533092 Myzus persicae, line F... 76 1e-19 3
(CU435554) Clytia hemisphaerica 5-PRIME EST from clone SA0AA... 56 2e-19 6
(CR382126) Kluyveromyces lactis strain NRRL Y-1140 chromosom... 101 3e-19 16
(EU444263) Saccharomyces paradoxus strain CBS8436 CIT2 gene,... 50 8e-19 5
(DV182326) CT005_G02_040112_3700_91.ab1 C. tentans tissue cu... 92 1e-18 2
(AY144918) Saccharomyces castellii clone Contig1542 CIT1 gen... 54 2e-18 5
(DY894605) CeleSEQ14216 Cunninghamella elegans pBluescript (... 70 3e-18 4
(CX615592) GABR1_21_C10.b1_A002 GA- or brassinolide-treated ... 58 3e-18 4
(BJ436097) Dictyostelium discoideum cDNA clone:ddv29o24, 3' ... 105 5e-18 1
(EU444270) Saccharomyces paradoxus strain CBS8444 CIT2 gene,... 50 7e-18 5
(EU444269) Saccharomyces paradoxus strain CBS8442 CIT2 gene,... 50 7e-18 5
(EU444268) Saccharomyces paradoxus strain CBS8441 CIT2 gene,... 50 7e-18 5
(EU444267) Saccharomyces paradoxus strain CBS8440 CIT2 gene,... 50 7e-18 5
(EU444266) Saccharomyces paradoxus strain CBS8439 CIT2 gene,... 50 7e-18 5
(EU444265) Saccharomyces paradoxus strain CBS8438 CIT2 gene,... 50 7e-18 5
(EU444264) Saccharomyces paradoxus strain CBS8437 CIT2 gene,... 50 7e-18 5
(EU444271) Saccharomyces cariocanus strain CBS8841 CIT2 gene... 56 2e-17 4
(EE009853) ROE00001767 Rhizopus oryzae Company Rhizopus oryz... 56 3e-17 4
(AZ932267) 474.dhz96g02.s1 Saccharomyces unisporus NRRL Y-15... 78 4e-17 3
(EJ574973) 1092960089453 Global-Ocean-Sampling_GS-29-01-01-1... 52 8e-17 3
(BJ427996) Dictyostelium discoideum cDNA clone:ddv10k07, 3' ... 101 9e-17 1
(FC816722) Sr_pAMT7_06o17_T7 S. ratti mixed stage pAMP Stron... 78 3e-16 4
(FC811231) Sr_pASP6_06o17_SP6 S. ratti mixed stage pAMP Stro... 78 4e-16 4
(FC815975) Sr_pAMT7_04l20_T7 S. ratti mixed stage pAMP Stron... 78 4e-16 4
(EU519446) Saccharomyces paradoxus strain Q15.1 chromosome I... 64 4e-16 7
(EU519443) Saccharomyces paradoxus strain Q4.1 chromosome II... 64 4e-16 7
(FC810550) Sr_pASP6_04l20_SP6 S. ratti mixed stage pAMP Stro... 78 5e-16 4
(EU519448) Saccharomyces paradoxus strain T18.2 chromosome I... 64 5e-16 7
(EU519445) Saccharomyces paradoxus strain Q14.4 chromosome I... 64 5e-16 7
(EU519444) Saccharomyces paradoxus strain Q6.1 chromosome II... 64 5e-16 7
(EU519447) Saccharomyces paradoxus strain Q43.5 chromosome I... 64 5e-16 7
(EU519451) Saccharomyces paradoxus strain T62.1 chromosome I... 64 5e-16 7
(EU519453) Saccharomyces paradoxus strain T76.6 chromosome I... 64 5e-16 7
(EU519452) Saccharomyces paradoxus strain T68.2 chromosome I... 64 5e-16 7
(EU519450) Saccharomyces paradoxus strain T32.1 chromosome I... 64 6e-16 7
(EU519449) Saccharomyces paradoxus strain T26.3 chromosome I... 64 6e-16 7
(EX148711) ZRA373F ZRA Zoophthora radicans cDNA clone ZRA373... 52 7e-16 4
(ES218168) MpFVN_ag3_A13 Myzus persicae, line F001, PLRV fre... 76 4e-15 2
(BI074105) kt40a08.y1 Strongyloides ratti L2 pAMP1 v1 Chiape... 78 1e-14 3
(DJ025882) Genome-wide DNA marker of Saccharomyces cerevisiae. 62 1e-14 3
(T36365) EST101292 S. cerevisiae strain X2180-1A Saccharomyc... 62 2e-14 3
(CZ283897) cp32d06.f Candida parapsilosis Random Genomic Lib... 52 2e-14 4
(BI502289) kt87g01.y1 Strongyloides ratti L2 pAMP1 v1 Chiape... 78 3e-14 3
(CR382138) Debaryomyces hansenii strain CBS767 chromosome F ... 68 3e-14 17
(FF084713) CPAD-aab29e05.b1 PB2801_EST_CPAD1 Caenorhabditis ... 52 4e-14 5
(FF101975) CPAD-aab91b01.b1 PB2801_EST_CPAD1 Caenorhabditis ... 52 5e-14 5
(FF098219) CPAD-aac03h07.b1 PB2801_EST_CPAD1 Caenorhabditis ... 52 6e-14 5
(FF094304) CPAD-aac51a03.b1 PB2801_EST_CPAD1 Caenorhabditis ... 52 7e-14 5
(FF107502) CPAD-aad63a05.b1 PB2801_EST_CPAD1 Caenorhabditis ... 52 7e-14 5
(EE001247) ROE00010959 Rhizopus oryzae Company Rhizopus oryz... 56 9e-14 4
(AY692837) Saccharomyces cerevisiae clone FLH113521.01X YCR0... 64 4e-13 4
(FF101841) CPAD-aab82f04.b1 PB2801_EST_CPAD1 Caenorhabditis ... 52 4e-13 5
(M14686) Yeast (S.cerevisiae) CIT2 gene encoding the cytopla... 64 7e-13 4
(FF084849) CPAD-aaa90h11.b1 PB2801_EST_CPAD1 Caenorhabditis ... 52 9e-13 5
(EE571058) C10_C10fv4b19_pDNRf_531394 Myzus persicae, line F... 68 9e-13 2
(EC761242) PSE00002688 rw_mgpallid Polysphondylium pallidum ... 54 9e-13 3
(EU444725) Saccharomyces cariocanus strain CBS8841 chromosom... 56 2e-12 2
(EU519441) Saccharomyces paradoxus strain CBS8441 chromosome... 50 3e-12 7
(EU519440) Saccharomyces paradoxus strain CBS8440 chromosome... 50 3e-12 7
(DW012437) w16p13_M13F Myzus persicae, tobacco lineage, whol... 76 4e-12 2
(EU519436) Saccharomyces paradoxus strain CBS8436 chromosome... 50 4e-12 8
(EU519437) Saccharomyces paradoxus strain CBS8437 chromosome... 50 4e-12 8
(EU444726) Saccharomyces paradoxus strain CBS8442 chromosome... 50 5e-12 8
(EU519439) Saccharomyces paradoxus strain CBS8439 chromosome... 50 5e-12 8
(EU519438) Saccharomyces paradoxus strain CBS8438 chromosome... 50 5e-12 8
(AL429961) clone BA0AB034H01 of library BA0AB from strain CL... 68 8e-12 3
(FD510778) C4_TOmix_Q0E03_TW C4_TOmix Caenorhabditis brenner... 52 2e-11 5
(FF103902) CPAD-aad37f03.b1 PB2801_EST_CPAD1 Caenorhabditis ... 52 2e-11 4
(EC998666) ROE00008050 Rhizopus oryzae Company Rhizopus oryz... 56 2e-11 3
(FD510776) C4_TOmix_O0E03_TW C4_TOmix Caenorhabditis brenner... 52 2e-11 5
(EU519442) Saccharomyces paradoxus strain CBS8444 chromosome... 50 3e-11 7
(EX265885) 1446376_5_M22_083 PY06 Carica papaya cDNA, mRNA s... 58 3e-11 4
(EX290553) 1578566_5_M20_068 PY06 Carica papaya cDNA, mRNA s... 58 4e-11 4
(EX274679) 1455733_5_C19_078 PY06 Carica papaya cDNA, mRNA s... 58 4e-11 4
(EH017012) USDA-FP_189456 Lysiphlebus testaceipes adult whol... 44 4e-11 4
(FF084011) CPAD-aaa10d02.b1 PB2801_EST_CPAD1 Caenorhabditis ... 52 4e-11 4
(EE000645) ROE00007955 Rhizopus oryzae Company Rhizopus oryz... 56 4e-11 3
(EX272565) 1453013_5_B11_048 PY06 Carica papaya cDNA, mRNA s... 58 4e-11 4
(EX272256) 1452917_5_N11_036 PY06 Carica papaya cDNA, mRNA s... 58 4e-11 4
(BF015069) kq60h04.y1 TBN95TM-SSR Strongyloides stercoralis ... 74 4e-11 2
(EE002168) ROE00003154 Rhizopus oryzae Company Rhizopus oryz... 56 4e-11 3
(EE002208) ROE00003564 Rhizopus oryzae Company Rhizopus oryz... 56 4e-11 3
(AB001565) Candida tropicalis DNA for citrate synthase, comp... 38 4e-11 6
(DJ208717) Method for identification of useful proteins deri... 64 5e-11 3
(CR380954) Candida glabrata strain CBS138 chromosome H compl... 70 5e-11 13
(EE009528) ROE00005474 Rhizopus oryzae Company Rhizopus oryz... 56 6e-11 3
(EE007481) ROE00003506 Rhizopus oryzae Company Rhizopus oryz... 56 6e-11 3
(EH641310) EST12418 LK04 Laupala kohalensis cDNA clone 10610... 68 7e-11 2
(EA376382) Sequence 25205 from patent US 7314974. 56 7e-11 4
(EE009515) ROE00005838 Rhizopus oryzae Company Rhizopus oryz... 56 8e-11 3
(DY889887) CeleSEQ6859 Cunninghamella elegans pBluescript (E... 46 1e-10 5
(DV604130) EST1207126 Glossina morsitans morsitans Fat body ... 44 1e-10 5
(FF097634) CPAD-aac14f11.b1 PB2801_EST_CPAD1 Caenorhabditis ... 50 1e-10 4
(DL130880) Bax-responsive genes for drug target identificati... 56 2e-10 4
(AX536470) Sequence 71 from Patent WO02064766. 56 2e-10 4
(AR941440) Sequence 71 from patent US 7101990. 56 2e-10 4
(CB283207) BT1478 Blomia tropicalis cDNA library Blomia trop... 50 4e-10 5
(DQ374006) Glossina morsitans morsitans ATP citrate synthase... 44 5e-10 5
(EH012068) USDA-FP_185005 Lysiphlebus testaceipes adult whol... 42 6e-10 4
(CF601952) tac44g04.x1 Hydra EST -IV Hydra magnipapillata cD... 62 8e-10 3
(FE844892) CAFH671.rev CAFH Pichia stipitis aerobic dextrose... 50 8e-10 4
(FE846464) CAFI748.rev CAFI Pichia stipitis aerobic dextrose... 50 8e-10 4
(FC660325) CAXW17660.rev CAXW Lottia gigantea from female go... 56 9e-10 3
(FE855399) CAFT850.rev CAFT Pichia stipitis oxygen limited d... 50 9e-10 4
(FG085342) CMRC-FF-IH0-aca-g-15-0-CMRC.r1 Ceratitis capitata... 42 9e-10 5
(FC741563) CBBI12543.rev CBBI Lottia gigantea 26h,37h,61h La... 56 1e-09 3
(FC741728) CBBI12641.rev CBBI Lottia gigantea 26h,37h,61h La... 56 1e-09 3
(FC733151) CBBG7698.rev CBBG Lottia gigantea 12,15,18h embry... 56 1e-09 3
(FC682390) CAXX1641.fwd CAXX Lottia gigantea from male gonad... 56 1e-09 3
(FC720978) CBBG13754.fwd CBBG Lottia gigantea 12,15,18h embr... 56 1e-09 3
(FC664303) CAXW3751.rev CAXW Lottia gigantea from female gon... 56 1e-09 3
(FC641334) CAXU5340.fwd CAXU Lottia gigantea from female gon... 56 1e-09 3
(FC607541) CAXS3365.fwd CAXS Lottia gigantea from head, foot... 56 1e-09 3
(CN558005) tae46f04.y1 Hydra EST Darmstadt I Hydra magnipapi... 70 2e-09 3
(AW333304) S20A2 AGS-1 Pneumocystis carinii cDNA 3', mRNA se... 46 2e-09 4
(DW621984) CLJ325-E02.x1d-t SHGC-CLJ2 Gasterosteus aculeatus... 40 2e-09 5
(AM719746) Cucumis melo subsp. melo EST, clone PS_12-D04-M13R. 44 3e-09 5
(Z11113) Yeast (S.cerevisiae) CIT2 gene encoding the cytopla... 56 3e-09 4
(FC281725) CAGN2497.fwd CAGN Nematostella vectensis Nemve mi... 40 3e-09 4
(EA377073) Sequence 25896 from patent US 7314974. 58 4e-09 4
(FF104727) CPAD-aad54d11.b1 PB2801_EST_CPAD1 Caenorhabditis ... 52 5e-09 4
(DT987873) CLJ233-H02.x1d-t SHGC-CLJ Gasterosteus aculeatus ... 40 6e-09 5
(DW615054) CLJ284-D01.y1d-s SHGC-CLJ2 Gasterosteus aculeatus... 64 6e-09 3
(AL429256) clone BA0AB030F08 of library BA0AB from strain CL... 64 7e-09 3
(EC999484) ROE00010863 Rhizopus oryzae Company Rhizopus oryz... 56 8e-09 2
(EE002383) ROE00014077 Rhizopus oryzae Company Rhizopus oryz... 56 8e-09 2
(EE000399) ROE00010403 Rhizopus oryzae Company Rhizopus oryz... 56 8e-09 2
(EE000557) ROE00011242 Rhizopus oryzae Company Rhizopus oryz... 56 8e-09 2
(DT987874) CLJ233-H02.y1d-s SHGC-CLJ Gasterosteus aculeatus ... 64 1e-08 3
(EC854466) HDE00004101 Hyperamoeba dachnaya Non-normalized (... 46 1e-08 3
(DB918677) Idiosepius paradoxus cDNA, clone:Ip_aB_032_P14, 5... 70 1e-08 3
(BG592465) EST491143 cSTS Solanum tuberosum cDNA clone cSTS1... 38 1e-08 5
(ES300275) _27Y_G08 Bermudagrass Normalized cDNA Library Cyn... 48 2e-08 3
(EX255776) 1435748_5_C02_013 PY06 Carica papaya cDNA, mRNA s... 48 2e-08 4
(FC641808) CAXU5613.fwd CAXU Lottia gigantea from female gon... 56 2e-08 3
(FC690808) CAXX2202.fwd CAXX Lottia gigantea from male gonad... 56 2e-08 3
(DY861349) ApulSEQ14828 Aureobasidium pullulans pBluescript ... 42 2e-08 5
(BI431795) EST534556 P. infestans-challenged potato leaf, co... 38 2e-08 5
(CN627925) tae86b05.y1 Hydra EST Darmstadt I Hydra magnipapi... 70 3e-08 2
(CN626769) tae99d06.y1 Hydra EST Darmstadt I Hydra magnipapi... 70 3e-08 2
(CN775244) tae71b07.y1 Hydra EST Darmstadt I Hydra magnipapi... 70 3e-08 2
(DV740396) ID0AFF1BC02CM1 ID0AFF Acyrthosiphon pisum cDNA cl... 72 3e-08 2
(T37038) EST102091 S. cerevisiae strain X2180-1A Saccharomyc... 40 3e-08 3
(DW615053) CLJ284-D01.x1d-t SHGC-CLJ2 Gasterosteus aculeatus... 40 4e-08 5
(DV604616) EST1207612 Glossina morsitans morsitans Fat body ... 44 4e-08 4
(DV616003) EST1218999 Glossina morsitans morsitans Fat body ... 44 4e-08 4
(DV611533) EST1214529 Glossina morsitans morsitans Fat body ... 44 4e-08 4
(CN626488) tae99d06.x1 Hydra EST Darmstadt I Hydra magnipapi... 70 4e-08 2
(DV738896) ID0AFF12AA04CM1 ID0AFF Acyrthosiphon pisum cDNA c... 72 4e-08 2
(DV601898) EST1204893 Glossina morsitans morsitans Fat body ... 44 4e-08 4
(CU435688) Clytia hemisphaerica 5-PRIME EST from clone SA0AA... 40 5e-08 5
(CN498133) E09_01317.AB1 Diabrotica virgifera virgifera midg... 44 6e-08 3
(CN756999) ID0AAA1AE04RM1 ApMS Acyrthosiphon pisum cDNA clon... 72 8e-08 1
(FC663687) CAXW3391.fwd CAXW Lottia gigantea from female gon... 56 9e-08 2
(FC754942) CBBI8374.fwd CBBI Lottia gigantea 26h,37h,61h Lar... 56 9e-08 2
(DB912043) Idiosepius paradoxus cDNA, clone:Ip_aB_005_D10, 5... 70 1e-07 2
(ES741221) HTAB-aab11a05.b1 Heterorhabditis_bacteriophora_HT... 38 1e-07 3
(ES412521) HTAB-aaa57d05.b2 Heterorhabditis_bacteriophora_HT... 38 1e-07 3
(ES743460) HTAB-aab29g12.b1 Heterorhabditis_bacteriophora_HT... 38 1e-07 3
(FF680166) HTAN-aaa04a03.b1 Heterorhabditis_bacteriophora_ES... 38 1e-07 3
(ES523621) BIG_AF_31441 Brine Shrimp embryos, 15 hours after... 64 1e-07 2
(CN627022) tae90d09.x1 Hydra EST Darmstadt I Hydra magnipapi... 68 1e-07 2
(ES522499) BIG_AF_30318 Brine Shrimp embryos, 15 hours after... 64 1e-07 2
(FG168421) AGN_RNC005xc07r1.ab1 AGN_RNC Nicotiana tabacum cD... 42 1e-07 4
(CN565380) tag24g03.y1 Hydra EST -Kiel 1 Hydra vulgaris cDNA... 62 1e-07 2
(FG159502) AGN_RNC022xh22r1.ab1 AGN_RNC Nicotiana tabacum cD... 42 2e-07 4
(FG157700) AGN_RNC025xk02r1.ab1 AGN_RNC Nicotiana tabacum cD... 42 2e-07 4
(FG163192) AGN_RNC015xb07r1.ab1 AGN_RNC Nicotiana tabacum cD... 42 2e-07 4
(FG163195) AGN_RNC015xb17r1.ab1 AGN_RNC Nicotiana tabacum cD... 42 2e-07 4
(FG163616) AGN_RNC014xa04r1.ab1 AGN_RNC Nicotiana tabacum cD... 42 2e-07 4
(FC696866) CAXX5778.fwd CAXX Lottia gigantea from male gonad... 48 2e-07 3
(FE846925) CAFI990.rev CAFI Pichia stipitis aerobic dextrose... 50 2e-07 3
(FE843963) CAFH1631.rev CAFH Pichia stipitis aerobic dextros... 50 2e-07 3
(FE843240) CAFH1222.rev CAFH Pichia stipitis aerobic dextros... 50 2e-07 3
(FE859108) CAFX709.rev CAFX Pichia stipitis oxygen limited x... 50 2e-07 3
(FE853289) CAFP2687.fwd CAFP Pichia stipitis aerobic xylose ... 50 2e-07 3
(CU533948) Theobroma cacao, mRNA sequence (KZ0AAK12YC14FM1). 52 2e-07 3
(FE853288) CAFP2687.rev CAFP Pichia stipitis aerobic xylose ... 50 2e-07 3
(BJ452561) Hordeum vulgare subsp. vulgare cv.Akashinriki cDN... 48 3e-07 4
(CN627589) tae86b05.x1 Hydra EST Darmstadt I Hydra magnipapi... 70 3e-07 1
(CB832935) USDA-FP_100963 Adult Alate Brown Citrus Aphid Tox... 52 4e-07 2
(EX054286) BR038930 floral buds cDNA library KBFS Brassica r... 50 6e-07 2
(EV020119) BNSCS2CT_UP_059_C03_18APR2007_027 Brassica napus ... 50 6e-07 2
(EX052027) BR036671 floral buds cDNA library KBFS Brassica r... 50 6e-07 2
(FD571417) RS2FQ33TF RS2(RS) Raphanus sativus cDNA 5', mRNA ... 50 6e-07 2
(EX055011) BR039655 floral buds cDNA library KBFS Brassica r... 50 6e-07 2
(BT006613) Arabidopsis thaliana At2g44350 mRNA, complete cds. 50 7e-07 3
(AX651877) Sequence 746 from Patent WO03000898. 50 7e-07 3
(AX506281) Sequence 976 from Patent WO0216655. 50 7e-07 3
(BW923414) Branchiostoma floridae cDNA, neurula clone:bfne07... 46 8e-07 3
(EX137030) BR120860 root cDNA library KHRT Brassica rapa sub... 50 9e-07 2
(EV173142) 0155773 Brassica napus Etiolated seedlings (Uni-Z... 50 9e-07 2
(DT937755) ZM_BFb0117F20.r ZM_BFb Zea mays cDNA 5', mRNA seq... 46 9e-07 3
(EX268511) 1448900_5_G02_009 PY06 Carica papaya cDNA, mRNA s... 58 9e-07 2
(DY864991) ApulSEQ000762 Aureobasidium pullulans pBluescript... 56 1e-06 3
(BX819832) Arabidopsis thaliana Full-length cDNA Complete se... 50 1e-06 3

>(BJ343985) Dictyostelium discoideum cDNA clone:dda17g21, 3' end,
single read.
Length = 711

Score = 1354 bits (683), Expect = 0.0
Identities = 683/683 (100%)
Strand = Plus / Minus

Query: 886 ctgccaatttcaatcgtatgttgggttacacctcaaaagatttcgatgaactcatgagac 945
Sbjct: 711 ctgccaatttcaatcgtatgttgggttacacctcaaaagatttcgatgaactcatgagac 652

Query: 946 tttacctcaccattcatactgatcatgaaggtggtaacgttaggtgctcatacaactcat 1005
Sbjct: 651 tttacctcaccattcatactgatcatgaaggtggtaacgttaggtgctcatacaactcat 592

Query: 1006 ttagtaggttccgccttatctgacagttatttatcattaagtgctggtatgtgtggtctt 1065
Sbjct: 591 ttagtaggttccgccttatctgacagttatttatcattaagtgctggtatgtgtggtctt 532

Query: 1066 gctggtccattacatggtttagccaatcaagaagtactttcatggacaatgaaattacaa 1125
Sbjct: 531 gctggtccattacatggtttagccaatcaagaagtactttcatggacaatgaaattacaa 472

Query: 1126 gaaaaattaggaaacaaagaagtctcaaatgaagttttatcagaagccatctgggaaggt 1185
Sbjct: 471 gaaaaattaggaaacaaagaagtctcaaatgaagttttatcagaagccatctgggaaggt 412

Query: 1186 ttaaacgctggtcgtgttgtaccaggatttggtcatgccgtcttaagaaagactgatcca 1245
Sbjct: 411 ttaaacgctggtcgtgttgtaccaggatttggtcatgccgtcttaagaaagactgatcca 352

Query: 1246 cgttacacttgtcaacgtgagtttgctcttaaacatttaccacaagatccattattcaaa 1305
Sbjct: 351 cgttacacttgtcaacgtgagtttgctcttaaacatttaccacaagatccattattcaaa 292

Query: 1306 ttagtcagccaaatctacgaagttgttccagatattttaactaaacacggtaaaaccaag 1365
Sbjct: 291 ttagtcagccaaatctacgaagttgttccagatattttaactaaacacggtaaaaccaag 232

Query: 1366 aacccatatccaaatgttgatgctcactctggttgtttattacaatactatggcttaaaa 1425
Sbjct: 231 aacccatatccaaatgttgatgctcactctggttgtttattacaatactatggcttaaaa 172

Query: 1426 gaacataacttctacactgttttattcggtgtttcaagagccattggtgttttatcatca 1485
Sbjct: 171 gaacataacttctacactgttttattcggtgtttcaagagccattggtgttttatcatca 112

Query: 1486 ttagtttgggatcgtatcttaggtcacccaatcgaaagaccaaaatcagtcaccactgaa 1545
Sbjct: 111 ttagtttgggatcgtatcttaggtcacccaatcgaaagaccaaaatcagtcaccactgaa 52

Query: 1546 tggatttcatcttacgtaaactc 1568
Sbjct: 51 tggatttcatcttacgtaaactc 29

Lambda K H
1.37 0.711 1.31

Matrix: blastn matrix:1 -3
Number of Sequences: 98226423
Number of Hits to DB: 1,754,391,415
Number of extensions: 95185069
Number of successful extensions: 7603585
Number of sequences better than 10.0: 2058
Length of query: 1726
Length of database: 98,766,808,389
Length adjustment: 24
Effective length of query: 1702
Effective length of database: 96,409,374,237
Effective search space: 164088754951374
Effective search space used: 164088754951374
X1: 11 (21.8 bits)
S2: 22 (44.1 bits)

protein update 2009. 8. 2
Homology vs Protein
Query= Contig-U16281-1 (Contig-U16281-1Q) /CSM_Contig/Contig-U16281-1Q.Seq.d
(1726 letters)

Database: nrp_A
3,268,448 sequences; 1,061,185,681 total letters


Score E
Sequences producing significant alignments: (bits) Value

(Q553V1) RecName: Full=Citrate synthase, mitochondrial; ... 399 0.0
AC116305_8(AC116305|pid:none) Dictyostelium discoideum chromosom... 398 0.0
(Q7ZWZ5) RecName: Full=Citrate synthase, mitochondrial; ... 265 e-149
(P0C1Z2) RecName: Full=Citrate synthase, mitochondrial; ... 268 e-148
(Q29RK1) RecName: Full=Citrate synthase, mitochondrial; ... 269 e-148
(Q0GNE0) RecName: Full=Citrate synthase, mitochondrial; ... 265 e-147
(Q0GNE1) RecName: Full=Citrate synthase, mitochondrial; ... 265 e-147
BC166040_1(BC166040|pid:none) Danio rerio citrate synthase, mRNA... 261 e-147
AF053631_1(AF053631|pid:none) Homo sapiens citrate synthase mRNA... 268 e-147
(Q6S9V8) RecName: Full=Citrate synthase, mitochondrial; ... 261 e-147
(Q6S9V7) RecName: Full=Citrate synthase, mitochondrial; ... 259 e-147
(P00889) RecName: Full=Citrate synthase, mitochondrial; ... 265 e-146
AF047042_1(AF047042|pid:none) Homo sapiens citrate synthase mRNA... 268 e-146
NRL(1CTS) citrate (si)-synthase (EC (with citrate) - pi... 265 e-146
NRL(2CTS) citrate (si)-synthase (EC (with citrate coenz... 265 e-146
AK005713_1(AK005713|pid:none) Mus musculus adult male testis cDN... 267 e-145
AK161295_1(AK161295|pid:none) Mus musculus adult male testis cDN... 267 e-145
FM992695_315(FM992695|pid:none) Candida dubliniensis CD36 chromo... 255 e-144
AK095856_1(AK095856|pid:none) Homo sapiens cDNA FLJ38537 fis, cl... 268 e-143
FM865901_1(FM865901|pid:none) Brissopsis lyrifera partial mRNA f... 259 e-142
(P00890) RecName: Full=Citrate synthase, mitochondrial; ... 251 e-142
CP000502_263(CP000502|pid:none) Pichia stipitis CBS 6054 chromos... 252 e-142
AY144810_1(AY144810|pid:none) Saccharomyces bayanus clone Contig... 247 e-141
AJ296102_1(AJ296102|pid:none) Podospora anserina cit1 gene for m... 257 e-140
BX640838_1(BX640838|pid:none) Homo sapiens mRNA; cDNA DKFZp686D2... 268 e-140
CU928180_527(CU928180|pid:none) Kluyveromyces thermotolerans str... 252 e-140
(P79024) RecName: Full=Citrate synthase, mitochondrial; ... 243 e-140
AJ243204_1(AJ243204|pid:none) Aspergilluse niger citA gene for c... 258 e-139
AM989984_29(AM989984|pid:none) Zygosaccharomyces rouxii strain C... 252 e-139
CR382131_112(CR382131|pid:none) Yarrowia lipolytica strain CLIB1... 243 e-139
(P51044) RecName: Full=Citrate synthase, mitochondrial; ... 258 e-139
AF193854_1(AF193854|pid:none) Saccharomyces kluyveri putative ci... 243 e-138
AM920427_540(AM920427|pid:none) Penicillium chrysogenum Wisconsi... 259 e-138
(P34085) RecName: Full=Citrate synthase, mitochondrial; ... 254 e-138
AY816050_1(AY816050|pid:none) Schistosoma japonicum SJCHGC00653 ... 243 e-137
DQ674540_1(DQ674540|pid:none) Coccidioides posadasii citrate syn... 256 e-137
M84187_1(M84187|pid:none) N.crassa mitochondrial citrate synthas... 252 e-137
(P23007) RecName: Full=Citrate synthase, mitochondrial; ... 245 e-137
AY126274_1(AY126274|pid:none) Candida krusei citrate synthase (C... 240 e-136
CR380954_165(CR380954|pid:none) Candida glabrata strain CBS138 c... 246 e-136
AE016814_190(AE016814|pid:none) Ashbya gossypii (= Eremothecium ... 244 e-136
AY085647_1(AY085647|pid:none) Arabidopsis thaliana clone 16528 m... 247 e-136
AP007162_524(AP007162|pid:none) Aspergillus oryzae RIB40 genomic... 251 e-135
(O80433) RecName: Full=Citrate synthase, mitochondrial; ... 246 e-135
(P20115) RecName: Full=Citrate synthase 4, mitochondrial; ... 247 e-135
(Q61JF9) RecName: Full=Probable citrate synthase, mitochondrial;... 231 e-130
(P34575) RecName: Full=Probable citrate synthase, mitochondrial;... 229 e-130
EF676654_1(EF676654|pid:none) Picea sitchensis clone WS02746_G08... 250 e-130
AK243001_1(AK243001|pid:none) Oryza sativa Japonica Group cDNA, ... 247 e-129
CP000585_177(CP000585|pid:none) Ostreococcus lucimarinus CCE9901... 255 e-129
AB272085_1(AB272085|pid:none) Phanerochaete chrysosporium Cit1 m... 240 e-129
A46546_1(A46546|pid:none) Sequence 2 from Patent WO9524487. &X8... 246 e-129
(P08679) RecName: Full=Citrate synthase, peroxisomal; E... 240 e-127
A46547_1(A46547|pid:none) Sequence 3 from Patent WO9524487. &X8... 233 e-127
CR382138_880(CR382138|pid:none) Debaryomyces hansenii strain CBS... 250 e-125
(Q4QDX3) RecName: Full=Probable citrate synthase, mitochondrial;... 234 e-118
(Q43175) RecName: Full=Citrate synthase, mitochondrial; ... 231 e-117
(A4HXU4) RecName: Full=Probable citrate synthase, mitochondrial;... 233 e-115
AM920435_1351(AM920435|pid:none) Penicillium chrysogenum Wiscons... 202 e-114
AP007150_478(AP007150|pid:none) Aspergillus oryzae RIB40 genomic... 200 e-113
(A4H9H8) RecName: Full=Probable citrate synthase, mitochondrial;... 227 e-113
CR380948_153(CR380948|pid:none) Candida glabrata strain CBS138 c... 222 e-113
DQ849026_1(DQ849026|pid:none) Hypocrea jecorina citrate synthase... 196 e-113
AM502236_70(AM502236|pid:none) Leishmania infantum chromosome 18. 225 e-113
CP000251_3658(CP000251|pid:none) Anaeromyxobacter dehalogenans 2... 254 e-113
AP006840_2542(AP006840|pid:none) Symbiobacterium thermophilum IA... 249 e-112
AM494955_76(AM494955|pid:none) Leishmania braziliensis chromosom... 223 e-111
DQ992409_1(DQ992409|pid:none) Mus spicilegus citrate synthase-li... 212 e-111
(Q9TEM3) RecName: Full=2-methylcitrate synthase, mitochondrial; ... 198 e-110
CR548612_250(CR548612|pid:none) Paramecium tetraurelia macronucl... 215 e-110
CR382131_22(CR382131|pid:none) Yarrowia lipolytica strain CLIB12... 194 e-110
CU633872_205(CU633872|pid:none) Podospora anserina genomic DNA c... 194 e-109
CP001124_1637(CP001124|pid:none) Geobacter bemidjiensis Bem, com... 239 e-108
CP000698_1554(CP000698|pid:none) Geobacter uraniireducens Rf4, c... 238 e-107
AY490258_1(AY490258|pid:none) Geobacter metallireducens citrate ... 230 e-104
AE014297_1491(AE014297|pid:none) Drosophila melanogaster chromos... 220 e-104
DQ992407_1(DQ992407|pid:none) Mus caroli citrate synthase-like p... 213 e-102
CP000482_1117(CP000482|pid:none) Pelobacter propionicus DSM 2379... 225 e-100
AY223083_1(AY223083|pid:none) Schistosoma japonicum clone ZZD131... 214 2e-96
EF489424_1(EF489424|pid:none) Toxoplasma gondii mitochondrial ci... 214 5e-95
CR382125_620(CR382125|pid:none) Kluyveromyces lactis strain NRRL... 185 1e-92
CR940348_292(CR940348|pid:none) Theileria annulata strain Ankara... 187 8e-89
BT054477_1(BT054477|pid:none) Zea mays full-length cDNA clone ZM... 238 1e-88
AY069260_1(AY069260|pid:none) Drosophila melanogaster GM05016 fu... 262 6e-87
AE016820_370(AE016820|pid:none) Ashbya gossypii (= Eremothecium ... 176 8e-85
AY144919_1(AY144919|pid:none) Saccharomyces castellii clone Cont... 177 3e-83
AM910988_67(AM910988|pid:none) Plasmodium knowlesi strain H chro... 181 2e-81
DQ403126_1(DQ403126|pid:none) Rattus norvegicus citrate synthase... 261 6e-81
NRL(5CSCB1) citrate (si)-synthase (EC, chain B, fragmen... 208 9e-80
NRL(1CSC1) citrate (si)-synthase (EC (with L-malate &N... 207 1e-79
DQ403122_1(DQ403122|pid:none) Loxodonta africana citrate synthas... 251 4e-79
DQ403129_1(DQ403129|pid:none) Lepus europaeus citrate synthase (... 252 5e-79
DQ403130_1(DQ403130|pid:none) Oryctolagus cuniculus citrate synt... 250 7e-79
DQ403128_1(DQ403128|pid:none) Cavia porcellus citrate synthase (... 249 9e-79
DQ403132_1(DQ403132|pid:none) Homo sapiens citrate synthase (CS)... 249 2e-78
DQ403120_1(DQ403120|pid:none) Didelphis virginiana citrate synth... 251 2e-78
DQ403131_1(DQ403131|pid:none) Tadarida brasiliensis citrate synt... 248 3e-78
DQ403125_1(DQ403125|pid:none) Mus musculus citrate synthase (CS)... 247 4e-78
DQ403140_1(DQ403140|pid:none) Bos taurus citrate synthase (CS) m... 246 2e-77
DQ403121_1(DQ403121|pid:none) Sminthopsis douglasi citrate synth... 248 2e-77
DQ403134_1(DQ403134|pid:none) Tupaia glis citrate synthase (CS) ... 244 3e-77
DQ403142_1(DQ403142|pid:none) Hippopotamus amphibius citrate syn... 244 4e-77
DQ403124_1(DQ403124|pid:none) Tamandua tetradactyla citrate synt... 244 1e-76
DQ403136_1(DQ403136|pid:none) Felis catus citrate synthase (CS) ... 243 1e-76
AK072950_1(AK072950|pid:none) Oryza sativa Japonica Group cDNA c... 247 1e-76
DQ403133_1(DQ403133|pid:none) Aotus trivirgatus citrate synthase... 242 1e-76
DQ403127_1(DQ403127|pid:none) Mesocricetus auratus citrate synth... 242 2e-76
FN392319_422(FN392319|pid:none) Pichia pastoris GS115 chromosome... 247 7e-76
DQ403123_1(DQ403123|pid:none) Dasypus novemcinctus citrate synth... 240 2e-75
T09334(T09334) citrate (si)-synthase (EC, mitochondrial... 246 1e-74
DQ403119_1(DQ403119|pid:none) Monodelphis domestica citrate synt... 237 5e-74
DQ403135_1(DQ403135|pid:none) Canis familiaris citrate synthase ... 232 2e-73
EF414562_1(EF414562|pid:none) Uncultured Geobacter sp. clone PLY... 134 5e-68
AY490262_1(AY490262|pid:none) Geobacter bemidjiensis citrate syn... 158 6e-66
AY490263_1(AY490263|pid:none) Desulfuromonas acetexigens citrate... 159 2e-65
AK293263_1(AK293263|pid:none) Homo sapiens cDNA FLJ55186 complet... 195 6e-63
AY144996_1(AY144996|pid:none) Saccharomyces kluyveri clone Conti... 182 2e-58
NRL(5CSCA2) citrate (si)-synthase (EC, chain A, fragmen... 129 4e-56
FJ814766_1(FJ814766|pid:none) Camellia sinensis cultivar Huanggu... 195 7e-54
EZ000444_1(EZ000444|pid:none) TSA: Culex tarsalis Ctar-290 citra... 213 1e-53
EU677704_1(EU677704|pid:none) Caenorhabditis brenneri mitochondr... 208 6e-53
FJ872394_1(FJ872394|pid:none) Glycine max cultivar Jiyu 70 putat... 162 2e-51
CU928178_181(CU928178|pid:none) Zygosaccharomyces rouxii strain ... 174 3e-50
BT055772_1(BT055772|pid:none) Zea mays full-length cDNA clone ZM... 198 6e-49
AM426219_2(AM426219|pid:none) Vitis vinifera contig VV79X005739.... 184 1e-44
AF461103_1(AF461103|pid:none) Bos taurus citrate synthase mRNA, ... 182 3e-44
DQ059757_1(DQ059757|pid:none) Gadus morhua citrate synthase (CIS... 84 7e-39
AB057662_1(AB057662|pid:none) Sesbania rostrata SrCS mRNA for ci... 83 1e-36
AM263442_1(AM263442|pid:none) Lubomirskia baicalensis partial mR... 156 3e-36
BX908798_1771(BX908798|pid:none) Parachlamydia-related symbiont ... 114 2e-26
AX172589_1(AX172589|pid:none) Sequence 79 from Patent WO0144476. 114 1e-23
AM262925_1(AM262925|pid:none) Phillyrea latifolia partial mRNA f... 106 2e-21
EU857821_1(EU857821|pid:none) Chaenocephalus aceratus citrate sy... 84 2e-19
CP000852_300(CP000852|pid:none) Caldivirga maquilingensis IC-167... 62 1e-16
NRL(5CSCA1) citrate (si)-synthase (EC, chain A, fragmen... 86 3e-15
CP000240_1860(CP000240|pid:none) Synechococcus sp. JA-2-3B'a(2-1... 56 9e-15
AB359458_1(AB359458|pid:none) Rickettsia sp. TCM1 gltA gene for ... 63 9e-15
CP000766_1320(CP000766|pid:none) Rickettsia rickettsii str. Iowa... 62 2e-14
(P51040) RecName: Full=Citrate synthase; EC=; &... 62 3e-14
CP001612_981(CP001612|pid:none) Rickettsia africae ESF-5, comple... 61 3e-14
AY743327_1(AY743327|pid:none) Rickettsia japonica GltA (gltA) ge... 61 3e-14
AF178035_1(AF178035|pid:none) Rickettsia sp. BJ-90 citrate synth... 61 3e-14
GQ255903_1(GQ255903|pid:none) Rickettsia sp. SGL01 citrate synth... 61 4e-14
AB444098_1(AB444098|pid:none) Rickettsia sp. GRA-1 gltA gene for... 61 4e-14
(Q59730) RecName: Full=Citrate synthase; EC=; Fl... 58 4e-14
(P51042) RecName: Full=Citrate synthase; EC=; &... 60 6e-14
AF140706_1(AF140706|pid:none) Rickettsia sp. IRS3 citrate syntha... 59 8e-14
(Q59759) RecName: Full=Citrate synthase; EC=; Fl... 60 1e-13
(P51039) RecName: Full=Citrate synthase; EC=; Fl... 59 1e-13
(Q59742) RecName: Full=Citrate synthase; EC=; Fl... 60 1e-13
EF219460_1(EF219460|pid:none) Rickettsia sp. IG-1 citrate syntha... 60 1e-13
DQ365806_1(DQ365806|pid:none) Candidatus Rickettsia kulagini str... 60 2e-13
AF210692_1(AF210692|pid:none) Rickettsia sp. California 2 citrat... 59 2e-13
U59735_1(U59735|pid:none) Rickettsia sp. Strain S citrate syntha... 59 2e-13
AF394897_1(AF394897|pid:none) Rickettsia sp. DT1 citrate synthas... 59 3e-13
EF219463_1(EF219463|pid:none) Rickettsia sp. TwKM01 citrate synt... 58 3e-13
U59730_1(U59730|pid:none) Rickettsia conorii Seven citrate synth... 58 4e-13
(P51041) RecName: Full=Citrate synthase; EC=; Fl... 57 4e-13
U59729_1(U59729|pid:none) Rickettsia rickettsii R (Bitterroot) c... 57 8e-13
AY375163_1(AY375163|pid:none) Rickettsia amblyommii citrate synt... 60 8e-13
CP000382_1765(CP000382|pid:none) Clostridium novyi NT, complete ... 53 9e-13
(Q1RGV8) RecName: Full=Citrate synthase; EC=; &... 59 1e-12
EF451001_1(EF451001|pid:none) Rickettsia sp. 'Argentina' citrate... 60 1e-12
AM889285_1830(AM889285|pid:none) Gluconacetobacter diazotrophicu... 77 3e-12
EF102236_1(EF102236|pid:none) Rickettsia parkeri strain At24 cit... 59 4e-12
DQ865206_1(DQ865206|pid:none) Rickettsia rhipicephali strain HJ5... 58 6e-12
EU567181_1(EU567181|pid:none) Rickettsia bellii strain Pontal ci... 57 8e-12
DQ517288_1(DQ517288|pid:none) Rickettsia bellii strain An4 citra... 57 8e-12
AY362703_1(AY362703|pid:none) Rickettsia bellii citrate synthase... 56 1e-11
U76908_1(U76908|pid:none) Rickettsia sp. citrate synthase (gltA)... 56 1e-11
DQ496220_1(DQ496220|pid:none) Citrus sinensis cultivar Bonanza m... 54 2e-11
U59714_1(U59714|pid:none) Rickettsia typhi Wilmington citrate sy... 58 2e-11
AY259084_1(AY259084|pid:none) Rickettsia aeschlimannii citrate s... 52 2e-11
CR954246_1612(CR954246|pid:none) Pseudoalteromonas haloplanktis ... 74 2e-11
CP000444_1692(CP000444|pid:none) Shewanella sp. MR-7, complete g... 74 2e-11
AY375161_1(AY375161|pid:none) Rickettsia bellii citrate synthase... 58 2e-11
CP000702_613(CP000702|pid:none) Thermotoga petrophila RKU-1, com... 73 3e-11
CP000469_1693(CP000469|pid:none) Shewanella sp. ANA-3, complete ... 73 3e-11
CP000447_2331(CP000447|pid:none) Shewanella frigidimarina NCIMB ... 73 4e-11
AJ269522_1(AJ269522|pid:none) Male-killing Rickettsia from Adali... 54 4e-11
CP000749_2774(CP000749|pid:none) Marinomonas sp. MWYL1, complete... 72 5e-11
CP000503_1718(CP000503|pid:none) Shewanella sp. W3-18-1, complet... 72 6e-11
(P20901) RecName: Full=Citrate synthase; EC=; Al... 72 6e-11
DQ631551_1(DQ631551|pid:none) Acetobacter aceti strain 1023 citr... 72 6e-11
CP000302_2173(CP000302|pid:none) Shewanella denitrificans OS217,... 72 8e-11
CP000284_61(CP000284|pid:none) Methylobacillus flagellatus KT, c... 72 8e-11
AP009386_673(AP009386|pid:none) Burkholderia multivorans ATCC 17... 71 1e-10
AM286690_1501(AM286690|pid:none) Alcanivorax borkumensis SK2, co... 71 1e-10
CP000083_2157(CP000083|pid:none) Colwellia psychrerythraea 34H, ... 71 1e-10
CU633749_2072(CU633749|pid:none) Cupriavidus taiwanensis str. LM... 71 1e-10
CP001601_765(CP001601|pid:none) Corynebacterium aurimucosum ATCC... 71 1e-10
CP001026_722(CP001026|pid:none) Burkholderia ambifaria MC40-6 ch... 70 2e-10
CP000615_1079(CP000615|pid:none) Burkholderia vietnamiensis G4 c... 70 2e-10
AF516333_1(AF516333|pid:none) Rickettsia sp. RF2125 citrate synt... 49 2e-10
DQ115890_1(DQ115890|pid:none) Rickettsia rickettsii strain Taiac... 53 2e-10
CP001504_745(CP001504|pid:none) Burkholderia glumae BGR1 chromos... 70 2e-10
CP000085_662(CP000085|pid:none) Burkholderia thailandensis E264 ... 70 2e-10
CP000510_2127(CP000510|pid:none) Psychromonas ingrahamii 37, com... 70 2e-10
CP000394_896(CP000394|pid:none) Granulibacter bethesdensis CGDNI... 70 3e-10
DQ865204_1(DQ865204|pid:none) Rickettsia bellii strain HJ7 citra... 51 3e-10
CP000680_2489(CP000680|pid:none) Pseudomonas mendocina ymp, comp... 69 4e-10
AP009044_956(AP009044|pid:none) Corynebacterium glutamicum R DNA... 69 4e-10
CP000352_2472(CP000352|pid:none) Ralstonia metallidurans CH34, c... 69 4e-10
CP000613_1158(CP000613|pid:none) Rhodospirillum centenum SW, com... 69 4e-10
AF497584_1(AF497584|pid:none) Rickettsia sp. RDa420 citrate synt... 51 4e-10
CP000821_2813(CP000821|pid:none) Shewanella sediminis HAW-EB3, c... 69 5e-10
CP000471_887(CP000471|pid:none) Magnetococcus sp. MC-1, complete... 69 5e-10
CP001635_1413(CP001635|pid:none) Variovorax paradoxus S110 chrom... 69 5e-10
CP001157_2880(CP001157|pid:none) Azotobacter vinelandii DJ, comp... 69 5e-10
BX248356_64(BX248356|pid:none) Corynebacterium diphtheriae gravi... 69 5e-10
DQ269435_1(DQ269435|pid:none) Candidatus Rickettsia gravesii cit... 54 5e-10
(P42457) RecName: Full=Citrate synthase; EC=; &... 69 7e-10
FM954972_2130(FM954972|pid:none) Vibrio splendidus LGP32 chromos... 69 7e-10
AM181176_1774(AM181176|pid:none) Pseudomonas fluorescens SBW25 c... 69 7e-10
CP000462_1871(CP000462|pid:none) Aeromonas hydrophila subsp. hyd... 69 7e-10
AX065419_1(AX065419|pid:none) Sequence 545 from Patent WO0100844... 69 7e-10
CP000090_2300(CP000090|pid:none) Ralstonia eutropha JMP134 chrom... 69 7e-10
CP001103_1854(CP001103|pid:none) Alteromonas macleodii 'Deep eco... 69 7e-10
CP000094_1608(CP000094|pid:none) Pseudomonas fluorescens Pf0-1, ... 69 7e-10
DQ150692_1(DQ150692|pid:none) Rickettsia rickettsii strain 1995H... 47 9e-10
AM398681_1272(AM398681|pid:none) Flavobacterium psychrophilum JI... 68 9e-10
CP000076_1687(CP000076|pid:none) Pseudomonas fluorescens Pf-5, c... 68 9e-10
CP000949_3494(CP000949|pid:none) Pseudomonas putida W619, comple... 68 1e-09
CS431060_1(CS431060|pid:none) Sequence 89 from Patent EP1710313.... 68 1e-09
AB082520_1(AB082520|pid:none) Corynebacterium efficiens gltA2 ge... 68 1e-09
CP000020_811(CP000020|pid:none) Vibrio fischeri ES114 chromosome... 68 1e-09
CP000712_1639(CP000712|pid:none) Pseudomonas putida F1, complete... 68 1e-09
CP000931_2475(CP000931|pid:none) Shewanella halifaxensis HAW-EB4... 68 1e-09
CP000472_2831(CP000472|pid:none) Shewanella piezotolerans WP3, c... 68 1e-09
AE015451_4141(AE015451|pid:none) Pseudomonas putida KT2440 compl... 68 1e-09
AX647845_1(AX647845|pid:none) Sequence 2037 from Patent EP1270724. 68 1e-09
CP001053_2769(CP001053|pid:none) Burkholderia phytofirmans PsJN ... 67 2e-09
CP000851_1777(CP000851|pid:none) Shewanella pealeana ATCC 700345... 67 2e-09
CP000606_1644(CP000606|pid:none) Shewanella loihica PV-4, comple... 67 2e-09
CS431062_1(CS431062|pid:none) Sequence 91 from Patent EP1710313.... 67 2e-09
(P49299) RecName: Full=Citrate synthase, glyoxysomal; E... 67 2e-09
CP000271_137(CP000271|pid:none) Burkholderia xenovorans LB400 ch... 67 2e-09
(P51034) RecName: Full=Citrate synthase; EC=; &... 67 2e-09
AE016853_2155(AE016853|pid:none) Pseudomonas syringae pv. tomato... 67 2e-09
AE017340_1502(AE017340|pid:none) Idiomarina loihiensis L2TR, com... 67 2e-09
CP000685_365(CP000685|pid:none) Flavobacterium johnsoniae UW101,... 67 2e-09
CP000644_2194(CP000644|pid:none) Aeromonas salmonicida subsp. sa... 67 2e-09
AE002098_921(AE002098|pid:none) Neisseria meningitidis MC58, com... 67 3e-09
CP000697_1706(CP000697|pid:none) Acidiphilium cryptum JF-5, comp... 67 3e-09
CP000267_1763(CP000267|pid:none) Rhodoferax ferrireducens T118, ... 67 3e-09
AL954747_2375(AL954747|pid:none) Nitrosomonas europaea ATCC 1971... 66 4e-09
CP000941_806(CP000941|pid:none) Xylella fastidiosa M12, complete... 66 4e-09
CP001020_1319(CP001020|pid:none) Coxiella burnetii CbuK_Q154, co... 66 5e-09
EU567177_1(EU567177|pid:none) Rickettsia sp. NOD citrate synthas... 48 6e-09
AE009442_711(AE009442|pid:none) Xylella fastidiosa Temecula1, co... 65 6e-09
AL646052_1990(AL646052|pid:none) Ralstonia solanacearum GMI1000 ... 65 6e-09
CP000890_1348(CP000890|pid:none) Coxiella burnetii RSA 331, comp... 65 6e-09
(P18789) RecName: Full=Citrate synthase; EC=; &... 65 6e-09
CR931997_426(CR931997|pid:none) Corynebacterium jeikeium K411 co... 65 6e-09
(P14165) RecName: Full=Citrate synthase; EC=; &... 65 6e-09
CP001562_644(CP001562|pid:none) Bartonella grahamii as4aup, comp... 65 6e-09
AM260525_822(AM260525|pid:none) Bartonella tribocorum CIP 105476... 65 6e-09
CP000884_2413(CP000884|pid:none) Delftia acidovorans SPH-1, comp... 65 6e-09
M29728_1(M29728|pid:none) P.aeruginosa NADH-sensitive citrate sy... 65 6e-09
CP001291_3988(CP001291|pid:none) Cyanothece sp. PCC 7424, comple... 62 7e-09
CP000304_1836(CP000304|pid:none) Pseudomonas stutzeri A1501, com... 65 8e-09
AP008230_4425(AP008230|pid:none) Desulfitobacterium hafniense Y5... 65 8e-09
CP000504_1659(CP000504|pid:none) Pyrobaculum islandicum DSM 4184... 60 1e-08
CP000667_2102(CP000667|pid:none) Salinispora tropica CNB-440, co... 65 1e-08
CP000511_4943(CP000511|pid:none) Mycobacterium vanbaalenii PYR-1... 65 1e-08
CP000655_759(CP000655|pid:none) Polynucleobacter necessarius sub... 65 1e-08
BX548175_2598(BX548175|pid:none) Prochlorococcus marinus MIT9313... 65 1e-08
CP000859_26(CP000859|pid:none) Desulfococcus oleovorans Hxd3, co... 61 1e-08
CP000964_3770(CP000964|pid:none) Klebsiella pneumoniae 342, comp... 64 1e-08
CU207211_1676(CU207211|pid:none) Herminiimonas arsenicoxydans ch... 64 1e-08
CP000850_2206(CP000850|pid:none) Salinispora arenicola CNS-205, ... 64 1e-08
CP000656_1713(CP000656|pid:none) Mycobacterium gilvum PYR-GCK, c... 64 1e-08
AB334779_1(AB334779|pid:none) Glycine max mRNA for peroxisomal c... 64 1e-08
(Q9SJH7) RecName: Full=Citrate synthase 3, peroxisomal; ... 64 1e-08
DQ372954_1(DQ372954|pid:none) Candidatus Rickettsia antechini ci... 46 2e-08
AM942444_1557(AM942444|pid:none) Corynebacterium urealyticum DSM... 64 2e-08
AE017126_185(AE017126|pid:none) Prochlorococcus marinus subsp. m... 64 2e-08
AP008955_431(AP008955|pid:none) Brevibacillus brevis NBRC 100599... 64 2e-08
BX294144_201(BX294144|pid:none) Rhodopirellula baltica SH 1 comp... 64 2e-08
CR954217_232(CR954217|pid:none) Ostreococcus tauri strain OTTH05... 64 2e-08
AE017283_1408(AE017283|pid:none) Propionibacterium acnes KPA1712... 64 2e-08
CP000285_1202(CP000285|pid:none) Chromohalobacter salexigens DSM... 64 2e-08
CP000660_2163(CP000660|pid:none) Pyrobaculum arsenaticum DSM 135... 60 3e-08
BA000023_641(BA000023|pid:none) Sulfolobus tokodaii str. 7 DNA, ... 63 3e-08
AM286415_2806(AM286415|pid:none) Yersinia enterocolitica subsp. ... 63 3e-08
CP000783_2558(CP000783|pid:none) Enterobacter sakazakii ATCC BAA... 63 3e-08
CP001010_902(CP001010|pid:none) Polynucleobacter necessarius sub... 63 3e-08
CP000439_1587(CP000439|pid:none) Francisella tularensis subsp. n... 63 3e-08
CP000653_1212(CP000653|pid:none) Enterobacter sp. 638, complete ... 63 3e-08
CP000283_2831(CP000283|pid:none) Rhodopseudomonas palustris BisB... 63 3e-08
CU928158_2304(CU928158|pid:none) Escherichia fergusonii ATCC 354... 63 3e-08
CP000266_578(CP000266|pid:none) Shigella flexneri 5 str. 8401, c... 63 3e-08
CP000524_568(CP000524|pid:none) Bartonella bacilliformis KC583, ... 63 4e-08
AE008923_3339(AE008923|pid:none) Xanthomonas axonopodis pv. citr... 63 4e-08
AM942759_557(AM942759|pid:none) Proteus mirabilis strain HI4320,... 63 4e-08
AP008229_1051(AP008229|pid:none) Xanthomonas oryzae pv. oryzae M... 63 4e-08
CP000084_1135(CP000084|pid:none) Candidatus Pelagibacter ubique ... 63 4e-08
AE008922_3186(AE008922|pid:none) Xanthomonas campestris pv. camp... 63 4e-08
CP000911_1136(CP000911|pid:none) Brucella suis ATCC 23445 chromo... 62 5e-08
AE016958_829(AE016958|pid:none) Mycobacterium avium subsp. parat... 62 5e-08
CP001577_287(CP001577|pid:none) Micromonas sp. RCC299 chromosome... 62 5e-08
CP001349_1464(CP001349|pid:none) Methylobacterium nodulans ORS 2... 62 5e-08
AY578115_1(AY578115|pid:none) Candidatus Rickettsia principis fr... 62 5e-08
CP000155_4527(CP000155|pid:none) Hahella chejuensis KCTC 2396, c... 62 7e-08
(P0ABH7) RecName: Full=Citrate synthase; EC=; &... 62 7e-08
CP000596_228(CP000596|pid:none) Ostreococcus lucimarinus CCE9901... 62 7e-08
CP000514_1132(CP000514|pid:none) Marinobacter aquaeolei VT8, com... 62 7e-08
A99722(A99722) citrate synthase [imported] - Escherichia coli (s... 62 7e-08
CP001339_1282(CP001339|pid:none) Thioalkalivibrio sp. HL-EbGR7, ... 62 7e-08
AE005174_744(AE005174|pid:none) Escherichia coli O157:H7 EDL933,... 62 7e-08
CP000250_2803(CP000250|pid:none) Rhodopseudomonas palustris HaA2... 62 7e-08
CR543861_2608(CR543861|pid:none) Acinetobacter sp. ADP1 complete... 62 9e-08
CP000943_619(CP000943|pid:none) Methylobacterium sp. 4-46, compl... 62 9e-08
CP001154_2403(CP001154|pid:none) Laribacter hongkongensis HLHK9,... 62 9e-08
AE016825_1070(AE016825|pid:none) Chromobacterium violaceum ATCC ... 62 9e-08
CP000490_867(CP000490|pid:none) Paracoccus denitrificans PD1222 ... 62 9e-08
CP000880_2135(CP000880|pid:none) Salmonella enterica subsp. ariz... 61 1e-07
AE005176_670(AE005176|pid:none) Lactococcus lactis subsp. lactis... 61 1e-07
AE005673_1893(AE005673|pid:none) Caulobacter crescentus CB15, co... 61 1e-07
DQ365803_1(DQ365803|pid:none) Rickettsia raoultii strain Marne c... 61 1e-07
AE017220_736(AE017220|pid:none) Salmonella enterica subsp. enter... 61 1e-07
DQ124930_1(DQ124930|pid:none) Rickettsia sibirica citrate syntha... 48 1e-07
CP000230_1595(CP000230|pid:none) Rhodospirillum rubrum ATCC 1117... 61 1e-07
CR522870_1088(CR522870|pid:none) Desulfotalea psychrophila LSv54... 61 1e-07
BX571863_215(BX571863|pid:none) Photorhabdus luminescens subsp. ... 61 1e-07
CP000777_989(CP000777|pid:none) Leptospira biflexa serovar Patoc... 61 1e-07
AK120755_1(AK120755|pid:none) Oryza sativa Japonica Group cDNA c... 61 1e-07
CP000435_2575(CP000435|pid:none) Synechococcus sp. CC9311, compl... 61 1e-07
CP000713_255(CP000713|pid:none) Psychrobacter sp. PRwf-1, comple... 61 1e-07
(Q59136) RecName: Full=Citrate synthase; EC=; Fl... 61 1e-07
FM211057_109(FM211057|pid:none) Photorhabdus asymbiotica subsp. ... 60 2e-07
CU459003_710(CU459003|pid:none) Magnetospirillum gryphiswaldense... 60 2e-07
CP000774_3164(CP000774|pid:none) Parvibaculum lavamentivorans DS... 60 2e-07
CT978603_2276(CT978603|pid:none) Synechococcus sp. RCC307 genomi... 60 2e-07
AE017282_803(AE017282|pid:none) Methylococcus capsulatus str. Ba... 60 2e-07
CP000561_550(CP000561|pid:none) Pyrobaculum calidifontis JCM 115... 59 2e-07
AB297808_1(AB297808|pid:none) Rickettsia asiatica gltA gene for ... 60 3e-07
AM233362_1788(AM233362|pid:none) Francisella tularensis subsp. h... 60 3e-07
AB297810_1(AB297810|pid:none) Rickettsia asiatica gltA gene for ... 60 3e-07
CP000915_114(CP000915|pid:none) Francisella tularensis subsp. me... 60 3e-07
CU928162_669(CU928162|pid:none) Escherichia coli ED1a chromosome... 60 3e-07
CP000878_179(CP000878|pid:none) Prochlorococcus marinus str. MIT... 60 3e-07
CP000608_116(CP000608|pid:none) Francisella tularensis subsp. tu... 60 3e-07
AE017223_1070(AE017223|pid:none) Brucella abortus biovar 1 str. ... 60 3e-07
AE008917_835(AE008917|pid:none) Brucella melitensis 16M chromoso... 60 3e-07
CP000661_3063(CP000661|pid:none) Rhodobacter sphaeroides ATCC 17... 60 3e-07
CP001400_2538(CP001400|pid:none) Sulfolobus islandicus M.14.25, ... 60 3e-07
CP000822_2377(CP000822|pid:none) Citrobacter koseri ATCC BAA-895... 60 3e-07
AM778914_28(AM778914|pid:none) Microcystis aeruginosa PCC 7806 g... 60 3e-07
AE014613_2015(AE014613|pid:none) Salmonella enterica subsp. ente... 60 3e-07
CP000542_1370(CP000542|pid:none) Verminephrobacter eiseniae EF01... 60 3e-07
(P94325) RecName: Full=Citrate synthase; EC=; &... 60 3e-07
AE009441_1166(AE009441|pid:none) Pyrobaculum aerophilum str. IM2... 58 4e-07
AF1834(AF1834) citrate synthase [imported] - Nostoc sp. (strain ... 56 4e-07
AJ012408_2(AJ012408|pid:none) Anabaena sp. PCC 7120 gltA gene an... 56 4e-07
DQ402514_1(DQ402514|pid:none) Candidatus Rickettsia uilenbergi c... 59 4e-07
CP001287_1330(CP001287|pid:none) Cyanothece sp. PCC 8801, comple... 59 4e-07
CR628336_1373(CR628336|pid:none) Legionella pneumophila str. Par... 59 4e-07
EF689743_1(EF689743|pid:none) Francisella sp. TX119 GltA gene, p... 59 4e-07
AP008957_4612(AP008957|pid:none) Rhodococcus erythropolis PR4 DN... 59 4e-07
AM743169_3623(AM743169|pid:none) Stenotrophomonas maltophilia K2... 59 6e-07
U76375_1(U76375|pid:none) Bradyrhizobium japonicum citrate synth... 59 6e-07
CP000453_2733(CP000453|pid:none) Alkalilimnicola ehrlichii MLHE-... 59 6e-07
CP001616_2198(CP001616|pid:none) Tolumonas auensis DSM 9187, com... 59 6e-07
CP001100_611(CP001100|pid:none) Chloroherpeton thalassium ATCC 3... 59 6e-07
CU207366_2770(CU207366|pid:none) Gramella forsetii KT0803 comple... 59 6e-07
CP000660_996(CP000660|pid:none) Pyrobaculum arsenaticum DSM 1351... 59 6e-07
EU359287_1(EU359287|pid:none) Rickettsia helvetica isolate 41-2 ... 59 6e-07
DQ513394_1(DQ513394|pid:none) Ehrlichia ruminantium strain Sanka... 59 7e-07
CP001321_2001(CP001321|pid:none) Haemophilus parasuis SH0165, co... 59 7e-07
(P51037) RecName: Full=Citrate synthase, chromosomal; E... 59 7e-07
DQ513396_1(DQ513396|pid:none) Ehrlichia ruminantium strain Seneg... 59 7e-07
DQ513397_1(DQ513397|pid:none) Ehrlichia ruminantium strain Kumm1... 59 7e-07
DQ513395_1(DQ513395|pid:none) Ehrlichia ruminantium strain Pokoa... 59 7e-07
AE017354_1389(AE017354|pid:none) Legionella pneumophila subsp. p... 59 7e-07
EF077650_1(EF077650|pid:none) Israeli tick typhus rickettsia str... 59 7e-07
CP000140_1047(CP000140|pid:none) Parabacteroides distasonis ATCC... 59 7e-07
AE016827_2371(AE016827|pid:none) Mannheimia succiniciproducens M... 59 7e-07
EF177484_1(EF177484|pid:none) Israeli tick typhus rickettsia str... 59 7e-07
(P20902) RecName: Full=Citrate synthase; EC=; &... 58 1e-06
BX569695_84(BX569695|pid:none) Synechococcus sp. WH8102 complete... 58 1e-06
CP000393_1330(CP000393|pid:none) Trichodesmium erythraeum IMS101... 58 1e-06
AE016822_1303(AE016822|pid:none) Leifsonia xyli subsp. xyli str.... 58 1e-06
(P51038) RecName: Full=Citrate synthase, plasmid; EC=2.... 58 1e-06
AF191033_1(AF191033|pid:none) Mycobacterium smegmatis citrate sy... 58 1e-06
CP001638_2430(CP001638|pid:none) Geobacillus sp. WCH70, complete... 58 1e-06
CP000781_4387(CP000781|pid:none) Xanthobacter autotrophicus Py2,... 58 1e-06
CP000362_2989(CP000362|pid:none) Roseobacter denitrificans OCh 1... 58 1e-06
AF120027_1(AF120027|pid:none) Rickettsia sp. DnS28 strain DnS28 ... 58 1e-06
CP001628_1466(CP001628|pid:none) Micrococcus luteus NCTC 2665, c... 58 1e-06
CP000097_277(CP000097|pid:none) Synechococcus sp. CC9902, comple... 58 1e-06
CP000975_332(CP000975|pid:none) Methylacidiphilum infernorum V4,... 58 1e-06
CP000738_1135(CP000738|pid:none) Sinorhizobium medicae WSM419, c... 58 1e-06
(Q59732) RecName: Full=Citrate synthase; EC=; Fl... 58 1e-06
AJ609645_1(AJ609645|pid:none) Wolbachia pipientis partial gltA g... 46 1e-06
CP001655_2847(CP001655|pid:none) Dickeya zeae Ech1591, complete ... 58 1e-06
AF311966_1(AF311966|pid:none) Ehrlichia sp. EHt224 citrate synth... 58 1e-06
CP000854_4572(CP000854|pid:none) Mycobacterium marinum M, comple... 58 1e-06
AF088222_1(AF088222|pid:none) Lactococcus lactis subsp. lactis c... 58 1e-06
CP000633_1875(CP000633|pid:none) Agrobacterium vitis S4 chromoso... 58 1e-06
CP000825_180(CP000825|pid:none) Prochlorococcus marinus str. MIT... 58 1e-06
AF304145_1(AF304145|pid:none) Ehrlichia sp. Yamaguchi citrate sy... 58 1e-06
CP000031_2111(CP000031|pid:none) Ruegeria pomeroyi DSS-3, comple... 58 1e-06
AF394896_1(AF394896|pid:none) Rickettsia tamurae strain AT-1 cit... 58 1e-06
CP000099_699(CP000099|pid:none) Methanosarcina barkeri str. Fusa... 57 2e-06
CP000449_1391(CP000449|pid:none) Maricaulis maris MCS10, complet... 57 2e-06
(Q10530) RecName: Full=Citrate synthase 1; EC=; ... 57 2e-06
EU359285_1(EU359285|pid:none) Rickettsia helvetica isolate 20-2 ... 57 2e-06
AM408590_950(AM408590|pid:none) Mycobacterium bovis BCG Pasteur ... 57 2e-06
CP001191_1583(CP001191|pid:none) Rhizobium leguminosarum bv. tri... 57 2e-06
CP001186_4606(CP001186|pid:none) Bacillus cereus G9842, complete... 57 2e-06
AY157738_1(AY157738|pid:none) Sinorhizobium fredii citrate synth... 57 2e-06
EU359286_1(EU359286|pid:none) Rickettsia helvetica isolate 21-2 ... 57 2e-06
CP001229_1075(CP001229|pid:none) Sulfurihydrogenibium azorense A... 57 2e-06
DQ365879_1(DQ365879|pid:none) Ehrlichia ewingii citrate synthase... 57 2e-06
CP000576_182(CP000576|pid:none) Prochlorococcus marinus str. MIT... 57 2e-06
CP000100_612(CP000100|pid:none) Synechococcus elongatus PCC 7942... 57 2e-06
CP001389_1323(CP001389|pid:none) Rhizobium sp. NGR234, complete ... 57 2e-06
AF304139_1(AF304139|pid:none) Anaplasma marginale South Idaho ci... 57 2e-06
CU458896_933(CU458896|pid:none) Mycobacterium abscessus chromoso... 57 2e-06
CP000133_1891(CP000133|pid:none) Rhizobium etli CFN 42, complete... 57 2e-06
CP001079_821(CP001079|pid:none) Anaplasma marginale str. Florida... 57 2e-06
AP008231_912(AP008231|pid:none) Synechococcus elongatus PCC 6301... 57 2e-06
AE007869_1367(AE007869|pid:none) Agrobacterium tumefaciens str. ... 57 2e-06
AF304143_1(AF304143|pid:none) Ehrlichia canis Oklahoma citrate s... 57 3e-06
DQ092215_1(DQ092215|pid:none) Rickettsia sp. IM32a citrate synth... 57 3e-06
CU234118_3905(CU234118|pid:none) Bradyrhizobium sp. ORS278,compl... 57 3e-06
CP000111_172(CP000111|pid:none) Prochlorococcus marinus str. MIT... 57 3e-06
BX548174_168(BX548174|pid:none) Prochlorococcus marinus MED4 com... 57 3e-06
AE009441_2530(AE009441|pid:none) Pyrobaculum aerophilum str. IM2... 57 3e-06
DQ513393_1(DQ513393|pid:none) Ehrlichia ruminantium strain Blaau... 57 3e-06
CP000108_311(CP000108|pid:none) Chlorobium chlorochromatii CaD3,... 57 3e-06
CP001016_1390(CP001016|pid:none) Beijerinckia indica subsp. indi... 57 3e-06
CP000699_3186(CP000699|pid:none) Sphingomonas wittichii RW1, com... 57 3e-06
(P80148) RecName: Full=Citrate synthase; EC=; &... 57 3e-06
BA000002_1122(BA000002|pid:none) Aeropyrum pernix K1 DNA, comple... 57 3e-06
CP001399_2667(CP001399|pid:none) Sulfolobus islandicus L.S.2.15,... 57 3e-06
CP000552_191(CP000552|pid:none) Prochlorococcus marinus str. MIT... 57 3e-06
CP001029_5120(CP001029|pid:none) Methylobacterium populi BJ001, ... 56 4e-06
DQ513391_1(DQ513391|pid:none) Ehrlichia ruminantium strain Mara8... 56 4e-06
EU839565_1(EU839565|pid:none) Mycobacterium lepromatosis citrate... 56 4e-06
CP000494_4229(CP000494|pid:none) Bradyrhizobium sp. BTAi1, compl... 56 4e-06
CP001402_2662(CP001402|pid:none) Sulfolobus islandicus M.16.4, c... 56 4e-06
FJ851108_1(FJ851108|pid:none) Uncultured Bartonella sp. clone Pd... 56 4e-06
(Q53554) RecName: Full=Citrate synthase; EC=; &... 56 4e-06
BA000023_1956(BA000023|pid:none) Sulfolobus tokodaii str. 7 DNA,... 56 4e-06
AF304146_1(AF304146|pid:none) Cowdria ruminantium citrate syntha... 56 4e-06
CP001656_2742(CP001656|pid:none) Paenibacillus sp. JDR-2, comple... 56 4e-06
CP000319_1622(CP000319|pid:none) Nitrobacter hamburgensis X14, c... 56 4e-06
CP000359_1513(CP000359|pid:none) Deinococcus geothermalis DSM 11... 56 4e-06
AE008384_1527(AE008384|pid:none) Methanosarcina mazei strain Goe... 56 4e-06
CP000436_967(CP000436|pid:none) Haemophilus somnus 129PT, comple... 56 5e-06
CP000947_1400(CP000947|pid:none) Haemophilus somnus 2336, comple... 56 5e-06
AE017355_4278(AE017355|pid:none) Bacillus thuringiensis serovar ... 56 5e-06
AF503167_1(AF503167|pid:none) Candidatus Rickettsia tarasevichia... 56 5e-06
CP000325_213(CP000325|pid:none) Mycobacterium ulcerans Agy99, co... 56 5e-06
CP000485_3963(CP000485|pid:none) Bacillus thuringiensis str. Al ... 56 5e-06
FJ269035_1(FJ269035|pid:none) Rickettsia sp. Intervales citrate ... 56 5e-06
AE016879_4470(AE016879|pid:none) Bacillus anthracis str. Ames, c... 56 5e-06
BA000004_3160(BA000004|pid:none) Bacillus halodurans C-125 DNA, ... 56 5e-06
BA000045_3012(BA000045|pid:none) Gloeobacter violaceus PCC 7421 ... 56 5e-06
CP001215_4701(CP001215|pid:none) Bacillus anthracis str. CDC 684... 56 5e-06
DQ168981_1(DQ168981|pid:none) Rickettsia tarasevichiae strain Us... 55 6e-06
CT971583_2292(CT971583|pid:none) Synechococcus WH7803 complete g... 55 6e-06
AI1632(AI1632) citrate synthase chain II homolog citZ [imported]... 55 6e-06
CP000908_4619(CP000908|pid:none) Methylobacterium extorquens PA1... 55 6e-06
CP000454_2789(CP000454|pid:none) Arthrobacter sp. FB24, complete... 55 6e-06
CP000922_504(CP000922|pid:none) Anoxybacillus flavithermus WK1, ... 55 6e-06
AE017194_4690(AE017194|pid:none) Bacillus cereus ATCC 10987, com... 55 8e-06
CP001175_983(CP001175|pid:none) Listeria monocytogenes HCC23, co... 55 8e-06
AE017333_2936(AE017333|pid:none) Bacillus licheniformis DSM 13, ... 55 8e-06
AJ564633_1(AJ564633|pid:none) Bartonella schoenbuchensis partial... 55 8e-06
DQ513392_1(DQ513392|pid:none) Ehrlichia ruminantium strain Ball3... 55 8e-06
AJ278186_1(AJ278186|pid:none) Bartonella schoenbuchii partial gl... 55 8e-06
CT573213_108(CT573213|pid:none) Frankia alni str. ACN14A chromos... 55 8e-06
CP000419_1038(CP000419|pid:none) Streptococcus thermophilus LMD-... 55 1e-05
AP009153_571(AP009153|pid:none) Gemmatimonas aurantiaca T-27 DNA... 55 1e-05
AF311965_1(AF311965|pid:none) Ehrlichia sp. ERm58 citrate syntha... 55 1e-05
CP000232_1095(CP000232|pid:none) Moorella thermoacetica ATCC 390... 55 1e-05
U59712_1(U59712|pid:none) Rickettsia sp. AB bacterium citrate sy... 55 1e-05
BA000030_5337(BA000030|pid:none) Streptomyces avermitilis MA-468... 55 1e-05
AY515124_1(AY515124|pid:none) Bartonella rattimassiliensis strai... 55 1e-05
CP000023_1169(CP000023|pid:none) Streptococcus thermophilus LMG ... 55 1e-05
FJ666770_1(FJ666770|pid:none) Rickettsia endosymbiont of Aulogym... 46 1e-05
FJ666757_1(FJ666757|pid:none) Rickettsia endosymbiont of Bombyli... 45 1e-05
FJ666759_1(FJ666759|pid:none) Rickettsia endosymbiont of Chrysop... 45 1e-05
AJ621309_1(AJ621309|pid:none) Thermoproteus tenax cis2 gene for ... 51 1e-05
BA000011_241(BA000011|pid:none) Thermoplasma volcanium GSS1 DNA,... 54 1e-05
BX571869_175(BX571869|pid:none) Photorhabdus luminescens subsp. ... 54 1e-05
FJ851103_1(FJ851103|pid:none) Uncultured Bartonella sp. clone Lf... 54 1e-05
AE017283_2213(AE017283|pid:none) Propionibacterium acnes KPA1712... 54 1e-05
FJ851107_1(FJ851107|pid:none) Uncultured Bartonella sp. clone Mm... 54 1e-05
CP000127_2527(CP000127|pid:none) Nitrosococcus oceani ATCC 19707... 54 1e-05
AG1270(AG1270) citrate synthase chain II homolog citZ [imported]... 54 1e-05
AB190318_2(AB190318|pid:none) Uncultured bacterium bzo32-1, bzo3... 54 1e-05
AM711867_2196(AM711867|pid:none) Clavibacter michiganensis subsp... 54 1e-05
AP006627_4031(AP006627|pid:none) Bacillus clausii KSM-K16 DNA, c... 54 2e-05
CP001213_1053(CP001213|pid:none) Bifidobacterium animalis subsp.... 54 2e-05
CP000474_2673(CP000474|pid:none) Arthrobacter aurescens TC1, com... 54 2e-05
(P21553) RecName: Full=Citrate synthase; EC=; &... 54 2e-05

>(Q553V1) RecName: Full=Citrate synthase, mitochondrial;
EC=; Flags: Precursor;
Length = 460

Score = 399 bits (1026), Expect(3) = 0.0
Identities = 201/201 (100%), Positives = 201/201 (100%)
Frame = +2





Score = 377 bits (969), Expect(3) = 0.0
Identities = 183/197 (92%), Positives = 184/197 (93%)
Frame = +1





Score = 130 bits (328), Expect(3) = 0.0
Identities = 61/61 (100%), Positives = 61/61 (100%)
Frame = +3


Query: 984 V 986
Sbjct: 261 V 261

Lambda K H
0.318 0.134 0.401

Lambda K H
0.267 0.0410 0.140

Matrix: BLOSUM62
Gap Penalties: Existence: 11, Extension: 1
Number of Sequences: 3268448
Number of Hits to DB: 2,719,677,105
Number of extensions: 54477250
Number of successful extensions: 138415
Number of sequences better than 10.0: 1251
Number of HSP's gapped: 136673
Number of HSP's successfully gapped: 1817
Length of query: 575
Length of database: 1,061,185,681
Length adjustment: 134
Effective length of query: 441
Effective length of database: 623,213,649
Effective search space: 274837219209
Effective search space used: 274837219209
Neighboring words threshold: 12
Window for multiple hits: 40
X1: 16 ( 7.3 bits)
X2: 38 (14.6 bits)
X3: 64 (24.7 bits)
S1: 41 (21.7 bits)
S2: 32 (16.9 bits)


psg: 0.90 gvh: 0.62 alm: 0.33 top: 0.73 tms: 0.00 mit: 0.40 mip: 0.06
nuc: 0.00 erl: 0.00 erm: 0.20 pox: 0.00 px2: 0.00 vac: 0.33 rnp: 0.00
act: 0.00 caa: 0.00 yqr: 0.00 tyr: 0.00 leu: 0.00 gpi: 0.00 myr: 0.00
dna: 0.00 rib: 0.00 bac: 0.00 m1a: 0.00 m1b: 0.00 m2 : 0.00 mNt: 0.00
m3a: 0.00 m3b: 0.00 m_ : 1.00

48.0 %: mitochondrial
20.0 %: cytoplasmic
20.0 %: nuclear
4.0 %: cytoskeletal
4.0 %: vacuolar
4.0 %: extracellular, including cell wall

>> prediction for Contig-U16281-1 is mit

VS (DIR, S) 7
VH (FL, L) 1
VF (FL, S) 92
AH (FL, L) 0
AF (FL, S) 19
SL (DIR, L) 3
SS (DIR, S) 0
SH (FL, L) 0
SF (FL, S) 14
CH (FL, L) 2
CF (FL, S) 9
FCL (DIR, L) 1
FC (DIR, S) 1