AV403854
Accession Number AV403854
Clone Name pg--0133
Length 713
GO check_date -
GO Iprscan Value
GO ID -
NR blast_date 10/09/28
NR value 98 %/123 aa
NR definition ref|ZP_03045664.1| tail length tape measure protein [Escherichia coli E22] gb|EDV82450.1| tail length tape measure protein [Escherichia coli E22]
Drosophila blast_date 10/08/28
Drosophila value n.h
Drosophila definition -
C.elegans blast_date 10/08/27
C.elegans value n.h
C.elegans definition -
Anopheles blast_date 10/09/10
Anopheles value n.h
Anopheles definition -
Apis blast_date 10/09/10
Apis value n.h
Apis definition -
Tribolium blast_date 10/09/10
Tribolium value n.h
Tribolium definition -
Cluster Size 11
Rep ID AV404025
cDNA library name pg--
Sequence
TCGTCAGGAAGACAGTGCTCATGCTGCCCTGCTGACCGCTTCAGGCAGAACTCCGGACGC
TGGAGAAGCATGCCGGAGCAAATGAGAAAATCAGCCAGCAGCGCCGGGATTTGTGGAAGG
CGGAGAGTCAGTTCGCGGTACTGGAGGAGGCGGCGCAACGTCGCCAGCTGTCTGCACAGG
AGAAATCCCTGCTGGCGCATAAAGATGAGACGCTGGAGTACAAACGCCAGCTGGCTGCAC
TTGGCGACAAGGTTACGTATCAGGAGCGCCTGAACGCGCTGGCGCACAGGCGGATAAATT
CGCACAGCAGCAACGGGCAAAACGGGCCGCCATTGATGCGAAAAGCCGGGGGCTGACTGA
CCGGCAGGCAGAACGGGAAGCCACGGAACAGCGCCTGAAGGAACAGTATGGCGATAATCC
GCTGGCGCTGAATAACGTCATGTCAGAGCAGAAAAAGACCTGGGCGGCTGAAGACCAGCT
TCGCGGGAACTGGATGGCAGGCCTGAAGTCCGGCTGGAGTGAGTGGGAAGAGAGCGCCAC
GGACAGTATGTCGCAGGTAAAAAGTGCAGCCACGCAGACCTTTGATGGTATTGCACAGAA
TATGGCGGCGATGCTGACCGGCACTGAGCAGAACTGGCGCACTTTCACCCGTTCCGTGCT
GTCCATGATGACAGAAATTCTGCTTAAGCAGGCAATGGTGGGGATTGTCGGGA