FS921686
Accession Number FS921686
Clone Name E_FL_fwgP_02G15_F_0
Length 611
GO check_date -
GO Iprscan Value
GO ID -
NR blast_date 10/09/28
NR value 55 %/171 aa
NR definition ref|XP_967018.2| PREDICTED: similar to restin (Reed-Steinberg cell-expressed intermediate filament-associated protein) [Tribolium castaneum]
Drosophila blast_date 10/09/13
Drosophila value 57 %/131 aa
Drosophila definition FBpp0165255|Dmoj\GI16038-PA
C.elegans blast_date 10/08/29
C.elegans value 40 %/105 aa
C.elegans definition F53F4.3#CE10958#WBGene00009987#S.pombe hypothetical protein SPAC4G9.01 like#status:Partially_confirmed#UniProt:Q20728#protein_i d:CAB01212.1
Anopheles blast_date 10/09/10
Anopheles value 64 %/115 aa
Anopheles definition AGAP009210-PA Protein|3R:28747856:28805494:-1|gene:AGAP009210
Apis blast_date 10/09/10
Apis value 65 %/132 aa
Apis definition gnl|Amel|GB30360-PB
Tribolium blast_date 10/09/10
Tribolium value 55 %/171 aa
Tribolium definition gi|189241063|ref|XP_967018.2| PREDICTED: similar to restin (Reed-Steinberg cell-expressed intermediate filament-associated protein) [Tribolium castaneum]
Cluster Size 20
Rep ID FS906662
cDNA library name fwgP
Sequence
GACACACGACCCGCGCATCTGCATCACGCAGGTCGCCACCACGCCCTTTTANGNCCGAGA
TACAATCACAAACTACGTTTTCCGAACTNCTTATCGAGGACTAATTCGATAATCCAAAGG
AATTTTTTTTTTGAAAATCATAAGATGCCCGTCGAAACCAAAATTAGCTTTTCCGACGGC
AGCTCGACGGACACGCTGAGGAAGCTTAGTGACGACCTATCTAGAAAACACCTATCAGAC
CACAGCGTGATATTGACAGAGGACACCGATAGCTTCATTATTGGTGAACGTGTTTGGGTA
GGCGGTACGAAACCTGGACAAATTGCTTATATCGGAGAAACGCAGTTTGCTCCCGGAGAG
TGGGCTGGGATAGTACTCGACGAGCCAATTGGTAAAAACGATGGATCAGTGGCAGGCGTT
CGTTATTTTCAATGTCCAGAGAAACGAGGTGTGTTTTCTCGATTGACTCGACTCACTAGA
GTTCCCTTCGCTATACACACACCGCACGATGCATCGCCCGTGTCGGATGCGGGGAGCGTG
TTCGAACGACCTCCTTCCGGCGCGGCTCGTCCCAAGCGGACCCTCTCGCCAAATGGAAGT
ATTCGCAGNAT