AU006052
Accession Number AU006052
Clone Name wv40412
Length 732
GO check_date -
GO Iprscan Value
GO ID -
NR blast_date 10/09/28
NR value 86 %/238 aa
NR definition ref|NP_001036831.1| saposin-related [Bombyx mori] dbj|BAA23126.1| BmP109 [Bombyx mori]
Drosophila blast_date 10/08/28
Drosophila value 46 %/175 aa
Drosophila definition FBpp0242246|Dwil\GK13103-PA
C.elegans blast_date 10/08/27
C.elegans value n.h
C.elegans definition -
Anopheles blast_date 10/09/10
Anopheles value 49 %/183 aa
Anopheles definition AGAP001082-PB Protein|X:23467516:23493461:-1|gene:AGAP001082
Apis blast_date 10/09/10
Apis value 40 %/184 aa
Apis definition gnl|Amel|GB16561-PA
Tribolium blast_date 10/09/10
Tribolium value 44 %/188 aa
Tribolium definition gi|91077504|ref|XP_966852.1| PREDICTED: similar to saposin isoform 1 [Tribolium castaneum]
Cluster Size 120
Rep ID FS791050
cDNA library name wv4
Sequence
CTGGAGCGCATGTTCGTGGCGGCGCCGCAGAGCAAGGCCGCCTGCGCGTTCTGCCAGTAC
TTCCTGCACTACTTGCAGGTGCAACTCAGCGACACCAGGACCGAGGACAAAGTGAAGGCC
GCAGTACAGGAGGCGTGCGACGTGCTACCCGACGCCCTCAACGGTGAATGCAAGGAGTTC
GTAACGCAGTACGGATCCGCCGTCATCGCTTTGCTCGTTCAAGAAATCGATCCCGCCAGC
GTATGTCCCGCTCTTCAAATCTGCCCTCAAACAGAAGAAATCCGCCGAGTCGACGTCAAT
TCTGAAAAATCTAACTGCCCCCTGTGCCTCTTCGCCGTTGAACAACTAGAATCGGTGCTC
AAGAACAACCGTAGTGAGGAGAACATTCGCAAGGCTCTGGACGGTCTCTGCACGCGGCTC
TCCCAGAAACTGCAGAGCGAGTGCATCGACTTCGTGGACACGTACTCGAGTCAGCTCGTC
GAGATGCTGGTGGCCGACATGAACGCGAAGGAGATCTGCGTGTTCCTGAAGCTGTGTCGG
GACCAACTGCACGATCCCCTCAAGCTGACCCACTCGTCCATAGACAAGTTCCACGCGAAG
CGACATTGAGAGGCGACAGGAACAACCACAGGAAGAAGTCGCTTCTGCCCAAACACATGC
TGGTTTCTGAATTCAGTGACGTCGAAACGAACGAGATTCTTGGACGACACGGTGAAACGG
TCGCCGCGTTTT