FS906986
Accession Number FS906986
Clone Name E_FL_fufe_09N12_F_0
Length 737
GO check_date -
GO Iprscan Value
GO ID -
NR blast_date 10/09/28
NR value 100 %/191 aa
NR definition ref|NP_001098700.1| nanos-M [Bombyx mori] dbj|BAF73619.1| nanos-M [Bombyx mori]
Drosophila blast_date 10/09/12
Drosophila value low homology
Drosophila definition -
C.elegans blast_date 10/08/29
C.elegans value n.h
C.elegans definition -
Anopheles blast_date 10/09/10
Anopheles value low homology
Anopheles definition -
Apis blast_date 10/09/10
Apis value low homology
Apis definition -
Tribolium blast_date 10/09/10
Tribolium value n.h
Tribolium definition -
Cluster Size 41
Rep ID FS918893
cDNA library name fufe
Sequence
GGTCATCATTTGTGTGTTGCGATAAAATCATAAATCTTAAAAACTAAACAATGGATGTTC
AAATACCGTTTATAGCTCATCATTCTGTAGGACAAACTTTTGAAGAAATTCTACCATCTA
CGTCTGCATACATTAAAAAACAGCCAGAGTTTTTGGAAAGTGGATGCATTTTGAAAAAAG
ATGCCTTACAGGCTGTGAAACTGGATCCCGCAGTTTTGGAGGCACAAATAACAGTGGAAA
CGAGAAAAATCGATGGAACCGATTCTACACAAACTCAAGTTTCTTCACAAGGAAGTGAAT
TACCCGCTGAGGCTCTGCGTGTCGACTTCAAGAAAATTGTGTCAATGCACGAGACAGCAC
TCCTCTCTTTGACTCCGGATCAGTATCAGTTCCTGCTAATTTACGTCGAAGCTCTTCGCC
AGAAGCGAATTGGTTTACAAAAGCATTTTGAGTGCGCCTTCTGTAAGAAAAATGGGGAGT
CAGTGTCATGGTACAGAACGCATGCTCTGAAGGATGGGCGCGGTCGGGTGAAGTGCCCTG
TACTTAGAGGGTTCCGCTGCCCGCGCTGTGGGGCCACCGGGGACCGAGCTCACACCATTA
AATATTGCCCACAGAACTCCGATTAATTAAGGTTGTGGGGACACCTGTTTTTAGCTATCT
GCTGCTTTGCTGTAGAGAAAAAACTCCATTGAATTTTATTTTTAAACAAGAAATAAATAA
TAATTACACTCAAAANA