AV398143
Accession Number AV398143
Clone Name NV021176
Length 745
GO check_date -
GO Iprscan Value
GO ID -
NR blast_date 10/09/28
NR value 100 %/213 aa
NR definition ref|NP_001040254.1| beadex/dLMO protein [Bombyx mori] gb|ABD36315.1| beadex/dLMO protein [Bombyx mori]
Drosophila blast_date 10/08/28
Drosophila value 74 %/175 aa
Drosophila definition FBpp0262745|Dyak\GE17735-PA
C.elegans blast_date 10/08/27
C.elegans value 37 %/121 aa
C.elegans definition ZC247.3#CE15150#WBGene00003000#locus:lin-11#LIM domain containing proteins (2 domains), homeobox protein (lim subfamily)#status:Confirmed#UniProt:P20154#protein_id:CA B02310.1
Anopheles blast_date 10/09/10
Anopheles value 86 %/145 aa
Anopheles definition AGAP010391-PA Protein|3L:2586943:2587651:1|gene:AGAP010391
Apis blast_date 10/09/10
Apis value 79 %/150 aa
Apis definition gnl|Amel|GB11268-PA
Tribolium blast_date 10/09/10
Tribolium value 81 %/180 aa
Tribolium definition gi|91080717|ref|XP_975367.1| PREDICTED: similar to beadex/dLMO protein [Tribolium castaneum]
Cluster Size 9
Rep ID FS794536
cDNA library name NV02
Sequence
GCCAGCTACATCGCAGGCAACGACTGTAACATCTGCACAGAATCCTCCTCAACCACAGAT
ATGCGCTGGGTGCAGCAAAGTGATCACCGAGCGGTATCTCTTGAAGGCTTTGGATCAACT
GTGGCACGAGGACTGTTTGAAGTGCGGCTGCTGCGACTGCCGACTCGGGGAGGTTGGCCA
CACTCTATACACGCGCGCCAACCTAATTCTCTGCAAGAGAGATTATTTGAGGTTATTCGG
CAATACTGGATACTGTGCCGCTTGTAATAAAGTGATCCCCGCGTTCGAAATGGTGATGAG
GGCTCGCAGTAACGTTTATCATCTGGAATGCTTCGCTTGCCAACAGTGCAACCACAGATT
TTGTGTGGGCGATCGATTCTATTTATGCGAAAATAAGATTCTCTGCGAGTACGATTACGA
AGAGAGGCTGGTTTTCGCAAACATGGCGTACAATCCACCACCGCTGGCACATCTCAAGCG
ACAGACTACGCATTTGCCTCCACCTCCGACGAGCGGTGCGATGGGCGGCCTCATGAACGG
GTCAGGTCGTTCCGGCTCCGTTTGCTGCCCCCCCGCACCTCAAGCCCCTGGGCCTCTCGG
CGACCAGCTGAGATTACCGCGTATGAGACGCGGCCCACCCGTATGCCAAGTATCAAAACT
GAACAGTCGTACTAAACTAAAGTAAGCGACCCAAAGACTAGAGCGTCAGTGTGTTAAAAC
AAAAGTGGGTAATTTGTGTCAGTGT