FS725108
Accession Number FS725108
Clone Name E_FL_bmmt_03L12_F_0
Length 350
GO check_date -
GO Iprscan Value
GO ID -
NR blast_date 10/09/28
NR value 58 %/105 aa
NR definition gb|ACY09589.1| cytochrome oxidase subunit 1 [Tetracis cachexiata]
Drosophila blast_date 10/09/03
Drosophila value low homology
Drosophila definition -
C.elegans blast_date 10/08/28
C.elegans value low homology
C.elegans definition -
Anopheles blast_date 10/09/10
Anopheles value n.h
Anopheles definition -
Apis blast_date 10/09/10
Apis value n.h
Apis definition -
Tribolium blast_date 10/09/10
Tribolium value n.h
Tribolium definition -
Cluster Size 3382
Rep ID AU001277
cDNA library name bmmt
Sequence
AAATTAATAATATAAGGGAGGGGGGTAGGAGTCAAAATCTTATATTATTTATTCGTGGGA
ATGCTATATCTGGTGCTCCTAGTATAAGAGGAACTAATCAATTTCCAAATCCTCCAATTA
TAATAGGTATAACTATAAAAAAAATTATAATAAAAGCATGTGCTGTTACAATAGTATTAT
AAATTTGATCATCTCCAATTAATGATCCTGGATTTCCTAATTCAGCTCGAATTAAAAGTC
TTAAAGATGTTCCAATTATTCCTGATCAAATACCAAAAATAAAATATAATGTTCCAATAT
CTTTATGATTTGTAGAATAAATTCATTTTCGCTAAAAAAGAAAAAAAAAA