AV399091
Accession Number AV399091
Clone Name NV060650
Length 689
GO check_date -
GO Iprscan Value
GO ID -
NR blast_date 10/09/28
NR value 71 %/209 aa
NR definition ref|XP_001648944.1| dendritic cell protein [Aedes aegypti] sp|Q17D30.1|EIF3M_AEDAE RecName: Full=Eukaryotic translation initiation factor 3 subunit M; Short=eIF3m gb|EAT44291.1| dendritic cell protein [Aedes aegypti]
Drosophila blast_date 10/08/28
Drosophila value 66 %/206 aa
Drosophila definition FBpp0276999|Dpse\GA20974-PA
C.elegans blast_date 10/08/27
C.elegans value low homology
C.elegans definition -
Anopheles blast_date 10/09/10
Anopheles value 72 %/208 aa
Anopheles definition AGAP012281-PA Protein|3L:39764272:39765694:1|gene:EIF3M_ANOGA
Apis blast_date 10/09/10
Apis value 66 %/206 aa
Apis definition gnl|Amel|GB13583-PA
Tribolium blast_date 10/09/10
Tribolium value 66 %/207 aa
Tribolium definition gi|91091954|ref|XP_968265.1| PREDICTED: similar to dendritic cell protein [Tribolium castaneum]
Cluster Size 74
Rep ID FS916297
cDNA library name NV06
Sequence
CGGCACCTCGCATTCACTTTAATGCTTATAAATAATAAATAAAAGAATACAGTTCGAAAA
AGGAATTAAAATGCAAGGGCCAGCTGTGTTTATGGACATATCCCTGGAAGATCAGGCACT
CGAACTGAGAAGATATTTTAAGAGCCTTGGCGCCGAGATTTCAGAAGAAAAATCACCTAA
GGGCATTGAGGATGATCTGCATAAGATCGTTGGGGTTTGTGATGCTTGTTTCAAAGAGCC
GAGTGAATCGGATATCGAAGCCATTCTGAACAGTATTGTCTCTATTATGGTTTCTATACC
ATTAGAAAGAGGAGAAAACCTTATCTTAGCATTTAGTCAAAGGCTCACTAAGGCTCCTGG
CCCTAAACTTGGAATGGTAGCTCTGCAATCGTTATGGAGACTTTACAACAACTTAGAACC
CAACTCCCCTCTAAGATACCATGTATATTATCATGTCATAGAACTGGCTGCACGAGTTGG
ATTTGTCAGGGAAGTCTTCACTGGAGTTGAGCAGCTTAGGAAAGAGTTTGCTAACTGCCC
ACCTTCTAATGAACAAATGCAGAAATTGTATCGGCTTTTACATCAAGTGTTAAAAGACCA
AAACAGTGAACTAGCTGCTAAAGTAATGATTGAGCTACTGGGCACATATACAGATGAAAA
TGCTTCATATGCCAGAGAAGACGCCATTA