FS860309
Accession Number FS860309
Clone Name E_FL_fner_12N15_R_0
Length 736
GO check_date -
GO Iprscan Value
GO ID -
NR blast_date 10/09/28
NR value 98 %/165 aa
NR definition ref|NP_001040402.1| preimplantation protein [Bombyx mori] gb|ABF51322.1| preimplantation protein [Bombyx mori]
Drosophila blast_date 10/09/11
Drosophila value 80 %/166 aa
Drosophila definition FBpp0277152|Dpse\GA17429-PA
C.elegans blast_date 10/08/29
C.elegans value 78 %/150 aa
C.elegans definition C30A5.3#CE32154#WBGene00016238#status:Confirmed#UniProt:P34349#prot ein_id:AAB59173.2
Anopheles blast_date 10/09/10
Anopheles value 80 %/165 aa
Anopheles definition AGAP007306-PA Protein|2L:45129594:45130689:-1|gene:AGAP007306
Apis blast_date 10/09/10
Apis value 80 %/165 aa
Apis definition gnl|Amel|GB19377-PA
Tribolium blast_date 10/09/10
Tribolium value 84 %/165 aa
Tribolium definition gi|91090602|ref|XP_972981.1| PREDICTED: similar to Mps one binder kinase activator-like 4 (Mob as tumor suppressor protein 4) (Dmob4) [Tribolium castaneum]
Cluster Size 14
Rep ID FS892290
cDNA library name fner
Sequence
ACTTGATTTACAGATCTATCAATACCATAAACCTATGTAGAATGAACATTGTATTGTGTT
AATGCATATAAATAATTTAATTTATATTGGTGTACACAATTTTTCACACTAAATTTAAAT
ATATAATTTAACCTTGGTAGTGGAAGAAACACAAGTATGTAAATAAATAAATTCAATTTA
AATGTTGTTTTCCATCAGAGAAATGTTTAAATTGTAATTGTTTAAACAAATTTCAAGCTT
CTGATTCACCAGCTGGTACTTCATCATCAAGTTTAGGTAAAATTAGAATTTCTTGAGGTA
TTATTGGGTATTTTGTTACAAAATATGTGAATCTCTTGCATAAATGAGTTTCTCTTTCAA
ATGCATCATAAATTGAACGATGATGAAAGTATGCATGTGAGAAGATCCTGTAAACCCTTC
TACAAACAGATCCCAACTTGGCAATTGATGAATCCTTGATGTTCACCCTGCTTGGAAAGT
ATTTATTGCTATTCAACAAGCAAGCTGCTCCATCTAGAGTGTGCCGTGTGTAATCAATGG
CTGGACATTCTTTAGGAGTTTTATGTGCTGCACACAGAAATATCCACTGTTCTGTTGCAG
TCATTTGTGTACATGTTTCAGGTTTGCATTCATTTTGTAGGCGCACAGCCAATCCATTGA
GCTCCATACAAAATTGTCTTAGATGTTCATACTTCCAAACACCTTCATCCCACACCTCTG
GCATCTTCAAATAGCT