FS908806
Accession Number FS908806
Clone Name E_FL_fufe_15F06_F_0
Length 865
GO check_date -
GO Iprscan Value
GO ID -
NR blast_date 10/09/28
NR value 64 %/229 aa
NR definition ref|XP_974421.1| PREDICTED: similar to synoviolin [Tribolium castaneum] gb|EFA06968.1| hypothetical protein TcasGA2_TC009927 [Tribolium castaneum]
Drosophila blast_date 10/09/12
Drosophila value 58 %/226 aa
Drosophila definition FBpp0126178|Dana\GF22986-PA
C.elegans blast_date 10/08/29
C.elegans value 50 %/217 aa
C.elegans definition F55A11.3#CE05945#WBGene00004768#locus:sel-11#Zinc finger, C3HC4 type (RING finger)#status:Confirmed#UniProt:Q20798#protein_id:CAA96 657.1
Anopheles blast_date 10/09/10
Anopheles value 58 %/229 aa
Anopheles definition AGAP003179-PA Protein|2R:33579884:33582374:1|gene:AGAP003179
Apis blast_date 10/09/10
Apis value 58 %/222 aa
Apis definition gnl|Amel|GB14313-PA
Tribolium blast_date 10/09/10
Tribolium value 64 %/229 aa
Tribolium definition gi|91087035|ref|XP_974421.1| PREDICTED: similar to synoviolin [Tribolium castaneum]
Cluster Size 6
Rep ID DC547331
cDNA library name fufe
Sequence
GAGGCGAACATACGATATGATGTTTTGAAAATGTTTTTAAGAACTATTAATATATTTCGG
AGTGCATAGAAATTTAATTAACGAGGCACATGAAGATATCATTTCGAAGGAGCTCCTAAA
AACTATCAAAATGAAGGCAGTGTTAGCGACGGTGATCAGTCTCGCGCTAACCACTGTGGT
TATCGGCAATGCATATTACCAAAAGAAACAGTTTTACCCTTCGATAGTTTATTTAACAAA
TTCAAATCCAAGCATGGCAGTGATGTATTTGCAAGCGTTTATTTTAGTTTTATTGGTGGG
AAAAATGCTAAGGAAAATATTCTTTGGTCAACTTCGACCTGCTGAGTTTGAGCATTTAAT
AGAAAGGTCATGGTATGCCATAACAGAGACGTGCTTAGCATTTACTGTCTTCAGAGATGA
TTTCAATCCAAAGTTCATTGCTCTCTTTACACTGTTGTTATTCCTGAAAGCATTCCACTG
GCTTGCTGAAGATAGAGTTGATTATATGGAGAGAAGTCCTGTTATTGGATGGGTGTTTCA
CATAAGGATTCTAAGCTTGCTAATGTTGTTGGCACACGCAGACTTCTACTTCATTCACCA
TGCGTATCATGTCACTACATCAAAAGGCCCATCGGTGCAGCTGGTATTTGGTTTTGAGTA
CAGCATACTTATCATCATGATTGCCAATATATTGATTAAGTATGTTCTACATGCCATCGA
CTCTCGTTGGGAAGCACCGTGGGAGAGCAAAGCAGCAGTTCTTTTGTACACAGAACTTGC
TATAAATTTCTTGAAAGTACTTCTCTATATTGGATTTGGTAGCTGTCATGGNCCGCATTT
ATACTCTTCCGTTATTTGCATTCCC