QM300173
ID 221098
Scientific name Malus x domestica
Family Rosaceae
Marker UDMdSSR_020
Source 1
Marker type SSR
Forward primer TCGTCTTCTTGCTCTTACCTCC
Reverse primer AAAACCCTAGCATTCAGTCAGC
Population RGT x GD ('Renetta Grigia di Torriana' x 'Golden Delicious', code 99411)|RGT x GRH ('Renetta Grigia di Torriana' x 'GoldRush', code 99412)
LG -
Chr Chr12
Linked trait apple skin russeting in RGT crosses
Trait type 3
DOI 10.1186/s12870-015-0507-4
PMID 26084469