| >ENV08000357 | |
| Data type | Environmental sample (ENV) from GenBank |
| Sequence ID | >ENV08000357 |
| Genome ID | ABMB01023544 |
| Phylum/Class | "viral fraction from water below the boundary layer (eg, crevices and benthic surfaces) of Kingman Atoll (Northern Line Islands)" |
| Species | - |
| Start position | 4 |
| End position | 80 |
| Direction | + |
| Amino acid | Arg |
| Anticodon | TCT |
| 1st Intron start position | 0 |
| 1st Intron end position | 0 |
| Seq. | GCGCCCTTAGCTCAGCTGGATAGAGCATCGGTTTTCTAAACCGAGGGTCGGAGGTTCGAG TCCTCCAGGGCGCGCCA |
| Upstream seq. | nnnnnnntgt |
| tRNA1-7 | GCGCCCT |
| tRNA8-9 | TA |
| tRNA10-13 | GCTC |
| tRNA14-21 | AGCTGGATA |
| tRNA22-25 | GAGC |
| tRNA26 | A |
| tRNA27-31 | TCGGT |
| tRNA32-38 | TTTCTAA |
| tRNA39-43 | ACCGA |
| tRNA44-48 | GGGTC |
| tRNA49-53 | GGAGG |
| tRNA54-60 | TTCGAGT |
| tRNA61-65 | CCTCC |
| tRNA66-72 | AGGGCGC |
| tRNA73-76 | GCCA |
| Downstream seq. | aaaacttgta |
| 1st Intron seq. | - |
| 2nd Intron start position | - |
| 2nd Intron end position | - |
| 2st Intron seq. | - |
| Decision from Dr. Muto | - |
| Decision from Dr. Inokuchi | - |
| Decision from Dr. Yamada | - |
| Comment of Dr. Muto | - |
| Comment of Dr. Inokuchi | - |
| Comment of Dr. Yamada | - |
| Final decision | reliable tRNA gene |
| Comments | - |
| Original database | ENV division in DDBJ/EMBL/GenBank |