>ENV08000364 | |
Data type | Environmental sample (ENV) from GenBank |
Sequence ID | >ENV08000364 |
Genome ID | ABMB01044773 |
Phylum/Class | "viral fraction from water below the boundary layer (eg, crevices and benthic surfaces) of Kingman Atoll (Northern Line Islands)" |
Species | - |
Start position | 97 |
End position | 19 |
Direction | - |
Amino acid | Lys |
Anticodon | TTT |
1st Intron start position | 0 |
1st Intron end position | 0 |
Seq. | CGCCTCCGTAGCTCAGTTGGTAGAGCAATCGGCTTTTAACCGATTGGTCACAGGTTCGAG TCCTGTCGGGGTATTCC |
Upstream seq. | atgaatcaaA |
tRNA1-7 | CGCCTCC |
tRNA8-9 | GT |
tRNA10-13 | AGCT |
tRNA14-21 | CAGTTGGTA |
tRNA22-25 | GAGC |
tRNA26 | A |
tRNA27-31 | ATCGG |
tRNA32-38 | CTTTTAA |
tRNA39-43 | CCGAT |
tRNA44-48 | TGGTC |
tRNA49-53 | ACAGG |
tRNA54-60 | TTCGAGT |
tRNA61-65 | CCTGT |
tRNA66-72 | CGGGGTA |
tRNA73-76 | TTCC |
Downstream seq. | Actggggtcg |
1st Intron seq. | - |
2nd Intron start position | - |
2nd Intron end position | - |
2st Intron seq. | - |
Decision from Dr. Muto | - |
Decision from Dr. Inokuchi | - |
Decision from Dr. Yamada | - |
Comment of Dr. Muto | - |
Comment of Dr. Inokuchi | - |
Comment of Dr. Yamada | - |
Final decision | reliable tRNA gene |
Comments | - |
Original database | ENV division in DDBJ/EMBL/GenBank |