>ENV08000444 | |
Data type | Environmental sample (ENV) from GenBank |
Sequence ID | >ENV08000444 |
Genome ID | ABMD01074784 |
Phylum/Class | "viral fraction from water below the boundary layer (eg, crevices and benthic surfaces) of Christmas Atoll (Kirtimati; Northern Line Islands)" |
Species | - |
Start position | 83 |
End position | 8 |
Direction | - |
Amino acid | Asn |
Anticodon | GTT |
1st Intron start position | 0 |
1st Intron end position | 0 |
Seq. | TCCTCGGTAGCTCAGTTGGTAGAGCAGTTGACTGTTAATCAATTGGTCGCAGGTTCGAGT CCTGCCCGAGGAGCCA |
Upstream seq. | tcgattttat |
tRNA1-7 | TCCTCGG |
tRNA8-9 | TA |
tRNA10-13 | GCTC |
tRNA14-21 | AGTTGGTA |
tRNA22-25 | GAGC |
tRNA26 | A |
tRNA27-31 | GTTGA |
tRNA32-38 | CTGTTAA |
tRNA39-43 | TCAAT |
tRNA44-48 | TGGTC |
tRNA49-53 | GCAGG |
tRNA54-60 | TTCGAGT |
tRNA61-65 | CCTGC |
tRNA66-72 | CCGAGGA |
tRNA73-76 | GCCA |
Downstream seq. | attaaccnnn |
1st Intron seq. | - |
2nd Intron start position | - |
2nd Intron end position | - |
2st Intron seq. | - |
Decision from Dr. Muto | - |
Decision from Dr. Inokuchi | - |
Decision from Dr. Yamada | - |
Comment of Dr. Muto | - |
Comment of Dr. Inokuchi | - |
Comment of Dr. Yamada | - |
Final decision | reliable tRNA gene |
Comments | - |
Original database | ENV division in DDBJ/EMBL/GenBank |