>ENV08000505 | |
Data type | Environmental sample (ENV) from GenBank |
Sequence ID | >ENV08000505 |
Genome ID | ABMD01195932 |
Phylum/Class | "viral fraction from water below the boundary layer (eg, crevices and benthic surfaces) of Christmas Atoll (Kirtimati; Northern Line Islands)" |
Species | - |
Start position | 85 |
End position | 9 |
Direction | - |
Amino acid | Val |
Anticodon | TAC |
1st Intron start position | 0 |
1st Intron end position | 0 |
Seq. | GGGTGATTAGCTCAGTTTGGTAGAGCATCTCGTTTACACCGAGAGGGTCGGCAGTTCGAT CCTGTCATCACCCACCA |
Upstream seq. | taccttgcgt |
tRNA1-7 | GGGTGAT |
tRNA8-9 | TA |
tRNA10-13 | GCTC |
tRNA14-21 | AGTTTGGTA |
tRNA22-25 | GAGC |
tRNA26 | A |
tRNA27-31 | TCTCG |
tRNA32-38 | TTTACAC |
tRNA39-43 | CGAGA |
tRNA44-48 | GGGTC |
tRNA49-53 | GGCAG |
tRNA54-60 | TTCGATC |
tRNA61-65 | CTGTC |
tRNA66-72 | ATCACCC |
tRNA73-76 | ACCA |
Downstream seq. | ttaaggttnn |
1st Intron seq. | - |
2nd Intron start position | - |
2nd Intron end position | - |
2st Intron seq. | - |
Decision from Dr. Muto | - |
Decision from Dr. Inokuchi | - |
Decision from Dr. Yamada | - |
Comment of Dr. Muto | - |
Comment of Dr. Inokuchi | - |
Comment of Dr. Yamada | - |
Final decision | reliable tRNA gene |
Comments | - |
Original database | ENV division in DDBJ/EMBL/GenBank |