| >ENV08000511 | |
| Data type | Environmental sample (ENV) from GenBank |
| Sequence ID | >ENV08000511 |
| Genome ID | ABMD01229791 |
| Phylum/Class | "viral fraction from water below the boundary layer (eg, crevices and benthic surfaces) of Christmas Atoll (Kirtimati; Northern Line Islands)" |
| Species | - |
| Start position | 97 |
| End position | 22 |
| Direction | - |
| Amino acid | Ala |
| Anticodon | GGC |
| 1st Intron start position | 0 |
| 1st Intron end position | 0 |
| Seq. | GGGGCTGTAGCTCAGTTGGCAGAGCACGTGCATGGCATGCACGGGGTCAGGGGTTCAAAT CCCCTCAGCTCCACAA |
| Upstream seq. | nnnnnnnntt |
| tRNA1-7 | GGGGCTG |
| tRNA8-9 | TA |
| tRNA10-13 | GCTC |
| tRNA14-21 | AGTTGGCA |
| tRNA22-25 | GAGC |
| tRNA26 | A |
| tRNA27-31 | CGTGC |
| tRNA32-38 | ATGGCAT |
| tRNA39-43 | GCACG |
| tRNA44-48 | GGGTC |
| tRNA49-53 | AGGGG |
| tRNA54-60 | TTCAAAT |
| tRNA61-65 | CCCCT |
| tRNA66-72 | CAGCTCC |
| tRNA73-76 | ACAA |
| Downstream seq. | acaaatatga |
| 1st Intron seq. | - |
| 2nd Intron start position | - |
| 2nd Intron end position | - |
| 2st Intron seq. | - |
| Decision from Dr. Muto | - |
| Decision from Dr. Inokuchi | - |
| Decision from Dr. Yamada | - |
| Comment of Dr. Muto | - |
| Comment of Dr. Inokuchi | - |
| Comment of Dr. Yamada | - |
| Final decision | reliable tRNA gene |
| Comments | - |
| Original database | ENV division in DDBJ/EMBL/GenBank |